ID: 993060162

View in Genome Browser
Species Human (GRCh38)
Location 5:83029451-83029473
Sequence GATCTTCTCTCAGCACCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993060162_993060169 24 Left 993060162 5:83029451-83029473 CCATGTGGTGCTGAGAGAAGATC No data
Right 993060169 5:83029498-83029520 GTGATTGTGGGACTTAGCATTGG No data
993060162_993060166 -7 Left 993060162 5:83029451-83029473 CCATGTGGTGCTGAGAGAAGATC No data
Right 993060166 5:83029467-83029489 GAAGATCTGTGCTCTTGGTGGGG No data
993060162_993060167 11 Left 993060162 5:83029451-83029473 CCATGTGGTGCTGAGAGAAGATC No data
Right 993060167 5:83029485-83029507 TGGGGAGAGTGCAGTGATTGTGG No data
993060162_993060164 -9 Left 993060162 5:83029451-83029473 CCATGTGGTGCTGAGAGAAGATC No data
Right 993060164 5:83029465-83029487 GAGAAGATCTGTGCTCTTGGTGG No data
993060162_993060165 -8 Left 993060162 5:83029451-83029473 CCATGTGGTGCTGAGAGAAGATC No data
Right 993060165 5:83029466-83029488 AGAAGATCTGTGCTCTTGGTGGG No data
993060162_993060168 12 Left 993060162 5:83029451-83029473 CCATGTGGTGCTGAGAGAAGATC No data
Right 993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993060162 Original CRISPR GATCTTCTCTCAGCACCACA TGG (reversed) Intergenic
No off target data available for this crispr