ID: 993060168

View in Genome Browser
Species Human (GRCh38)
Location 5:83029486-83029508
Sequence GGGGAGAGTGCAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993060161_993060168 22 Left 993060161 5:83029441-83029463 CCAGCAGCTGCCATGTGGTGCTG No data
Right 993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG No data
993060160_993060168 23 Left 993060160 5:83029440-83029462 CCCAGCAGCTGCCATGTGGTGCT No data
Right 993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG No data
993060162_993060168 12 Left 993060162 5:83029451-83029473 CCATGTGGTGCTGAGAGAAGATC No data
Right 993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993060168 Original CRISPR GGGGAGAGTGCAGTGATTGT GGG Intergenic
No off target data available for this crispr