ID: 993060499

View in Genome Browser
Species Human (GRCh38)
Location 5:83032898-83032920
Sequence CAGGGCAAACTTAAGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993060499_993060506 17 Left 993060499 5:83032898-83032920 CCCTACTCCTTAAGTTTGCCCTG No data
Right 993060506 5:83032938-83032960 CCAAAGAGTAAAATAAGGAAAGG No data
993060499_993060504 12 Left 993060499 5:83032898-83032920 CCCTACTCCTTAAGTTTGCCCTG No data
Right 993060504 5:83032933-83032955 TCTTTCCAAAGAGTAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993060499 Original CRISPR CAGGGCAAACTTAAGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr