ID: 993068652

View in Genome Browser
Species Human (GRCh38)
Location 5:83132020-83132042
Sequence GGTTGTTCCTTTCCACGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 2, 1: 23, 2: 19, 3: 25, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993068652 Original CRISPR GGTTGTTCCTTTCCACGTTT GGG Intronic