ID: 993068910

View in Genome Browser
Species Human (GRCh38)
Location 5:83134003-83134025
Sequence GGTTCCAGGTGAGCACGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 1, 2: 5, 3: 21, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993068910 Original CRISPR GGTTCCAGGTGAGCACGGGC TGG Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900217972 1:1491849-1491871 GGTTCCAAGTGGGGACGGCCTGG - Intronic
903448423 1:23437000-23437022 GGATGCAGGTGAGCACGCCCAGG + Exonic
904341880 1:29840660-29840682 GGTTACAGGTTAGCACAGGTTGG - Intergenic
905395532 1:37664078-37664100 GTTTCCAGGTGGGCTAGGGCTGG - Intergenic
905460787 1:38121561-38121583 GCTACCAGAAGAGCACGGGCCGG + Intergenic
906535949 1:46551050-46551072 TGTTCTGGGTGAGCAGGGGCTGG - Exonic
910683631 1:89893185-89893207 GGTGCCAGCTGAGCTAGGGCAGG + Intronic
912771008 1:112464509-112464531 GGTTTCAGGTCAGCTCGGGGAGG - Intergenic
916080633 1:161229760-161229782 TGTTCCAGGTGAGCTGGGGAAGG + Exonic
917035658 1:170744698-170744720 GGCTCCAGGTGGGCACATGCAGG - Intergenic
922949858 1:229549608-229549630 GGTTCCAGGTGAGAACAAGCAGG + Intronic
923086035 1:230704138-230704160 GGTTCCAAGTGTGCACAGGGTGG - Intronic
923537832 1:234866713-234866735 GGATGCAGGTGAGGACGGGCTGG - Intergenic
1064297211 10:14089380-14089402 GGTTCCCAGAGAGGACGGGCTGG + Intronic
1066615084 10:37285474-37285496 AGTTCCAGGTGGGCATGGGCTGG - Intronic
1068460351 10:57321573-57321595 AGTTCCAGGTGGGCGTGGGCTGG + Intergenic
1072211231 10:93248828-93248850 GGATCCAGGTTAGCAGAGGCCGG + Intergenic
1072637812 10:97188558-97188580 GGTGGCAGGTGAGCAGGGACAGG - Intronic
1075492993 10:122890211-122890233 TGTTTCAGCTGAGCAGGGGCTGG - Intergenic
1076214706 10:128684067-128684089 GCTTCCAGGTGAGCCCGGTCAGG + Intergenic
1076373496 10:129969018-129969040 GCTTCCAAGTGAGAACGTGCAGG + Intergenic
1076374166 10:129972587-129972609 GGTTCCTGGCGAGCACTGCCTGG - Intergenic
1078147833 11:8734030-8734052 GGCTTCAGGTCAGCACAGGCAGG - Intronic
1083662528 11:64258399-64258421 GGTTCCAGGTGGGGCCGGGGTGG + Intronic
1085413804 11:76307199-76307221 GGTTCGAGGTGAGGTCTGGCAGG - Intergenic
1085510034 11:77083489-77083511 GTTTCCAGGGGAGCTTGGGCAGG + Intronic
1088737820 11:112742745-112742767 GTTTCCTGGTGTGCAGGGGCTGG + Intergenic
1090799194 11:130160053-130160075 GGCACGAGGTGAGCGCGGGCCGG + Exonic
1091588421 12:1828901-1828923 GGGACCAGGTCAGCAAGGGCTGG + Intronic
1095743439 12:45631942-45631964 GGTTTCAGGTGAGCAAGGACTGG + Intergenic
1097156073 12:57013256-57013278 TGTACCAGGTGAGAAGGGGCTGG + Intronic
1100771902 12:97932698-97932720 GGTTCAAGGTGAACTCTGGCTGG - Intergenic
1105806170 13:23952909-23952931 GGTTCCGGGTGGGCACAGGCTGG - Intergenic
1113443407 13:110347158-110347180 GGTTTCAGGTGAGGACAGGTAGG - Intronic
1113659137 13:112092795-112092817 GGTCCCAGAGGAGCCCGGGCAGG - Intergenic
1114267344 14:21080775-21080797 AGGTCCAGGTGAGAAGGGGCTGG + Exonic
1114938335 14:27573336-27573358 AGTTCCAGGTGAGTACATGCTGG - Intergenic
1118776855 14:68978834-68978856 GGTTCCGGGCGCGCACGGGAGGG - Intronic
1121665358 14:95667698-95667720 GATTCCAGGTGAGCCCAGACAGG - Intergenic
1122077418 14:99245515-99245537 GGATCCAGGTGAGGCCGGGACGG - Intronic
1123072071 14:105646817-105646839 AGCGGCAGGTGAGCACGGGCTGG - Intergenic
1123092074 14:105746344-105746366 AGCCGCAGGTGAGCACGGGCTGG - Intergenic
1123097411 14:105773078-105773100 CGCTGCAGGTGAGCAGGGGCAGG - Intergenic
1123097523 14:105773550-105773572 AGTCGCAGGTGAGCACGGGTTGG - Intergenic
1123097612 14:105773863-105773885 AGCTGCAGGTGAGCAGGGGCTGG - Intergenic
1123097629 14:105773942-105773964 AGCTGCAGGTGAGCAGGGGCTGG - Intergenic
1126098626 15:45106513-45106535 AGTGCCAGGTGAGCAGGGGCTGG - Exonic
1126191800 15:45886023-45886045 GGTTCTGGGTGGGCACGGGCTGG + Intergenic
1127378834 15:58410382-58410404 GGTTCCAGCTGTACAGGGGCTGG + Intronic
1127768098 15:62207590-62207612 GGTTCCTGGTGGGCACGGGCTGG + Intergenic
1128257198 15:66205680-66205702 TGTGCCAGCTGAGCACGGGTAGG - Intronic
1129165125 15:73772721-73772743 AGTTACAGGTCAGCACAGGCTGG + Intergenic
1131912568 15:97224300-97224322 AGTTCCGGGTGGGCACGGGCTGG + Intergenic
1133843768 16:9435528-9435550 AGTCGCAGGTGAGCACGGGTTGG + Intergenic
1136637936 16:31537582-31537604 GGTCCCAGGTGAGCTGCGGCCGG - Intergenic
1136666790 16:31819571-31819593 GGTCCCAGGTGAGCTGCGGCCGG + Intergenic
1139088540 16:63617442-63617464 GGTTCCGGGTGGGCGCAGGCTGG - Intergenic
1141749010 16:85945958-85945980 GCTGCCAGGTGAGAACAGGCAGG + Intergenic
1142869013 17:2808610-2808632 AGTTCCAGGTGAGCACTGGCCGG + Intronic
1144760844 17:17706458-17706480 GGATCCAGGTGGACAAGGGCTGG + Intronic
1147159664 17:38562760-38562782 GGGTCCAGGGGAGCAGGGTCTGG - Intronic
1147168193 17:38604464-38604486 GGAGCCAGGTGAGCAGGCGCGGG - Intronic
1148455648 17:47809735-47809757 GGTTCCTGGTGCCCAGGGGCAGG - Intronic
1151854419 17:76710816-76710838 GGTTCCGGGGGCGCGCGGGCAGG + Exonic
1152117560 17:78397966-78397988 GTTTCCAGGGTGGCACGGGCTGG + Intronic
1152218430 17:79047830-79047852 GGTTCCAGGTGTGCACGTTGAGG - Exonic
1152592620 17:81221337-81221359 GGTGCCATGTGGGGACGGGCTGG - Intronic
1153985036 18:10343958-10343980 GGTTCCCTGGGAGCACTGGCCGG + Intergenic
1154012670 18:10589195-10589217 GGCTCCAGGTGGCCCCGGGCCGG + Intergenic
1156118957 18:33820232-33820254 GGTTCCGGGTGGGCGCCGGCTGG - Intergenic
1156577064 18:38329375-38329397 GATTACAGGTGAGCACAGTCAGG - Intergenic
1159040213 18:63318099-63318121 GGATCCAGGTGTGCAGGTGCCGG + Exonic
1159928669 18:74291343-74291365 GCTCCCAGGTGTGCACGCGCAGG + Intronic
1160704370 19:523185-523207 CATTTCCGGTGAGCACGGGCCGG + Intergenic
1160704410 19:523345-523367 CATTTCCGGTGAGCACGGGCCGG + Intergenic
1160704419 19:523379-523401 CATTTCCGGTGAGCACGGGCCGG + Intergenic
1160704428 19:523410-523432 CATTTCCGGTGAGCACGGGCCGG + Intergenic
1160704437 19:523444-523466 CATTTCCGGTGAGCACGGGCCGG + Intergenic
1160704446 19:523478-523500 CATTTCCGGTGAGCACGGGCCGG + Intergenic
1160704464 19:523543-523565 CATTTCCGGTGAGCACGGGCCGG + Intergenic
1160704474 19:523577-523599 CATTTCCGGTGAGCACGGGCCGG + Intergenic
1160704484 19:523611-523633 CATTTCCGGTGAGCACGGGCCGG + Intergenic
1160704494 19:523645-523667 CATTTCCGGTGAGCACGGGCTGG + Intergenic
1161452455 19:4354154-4354176 AGATCCAGGTGAGCTGGGGCAGG - Intronic
1161526148 19:4756893-4756915 GGTTGGAGGTTAGCAGGGGCTGG + Intergenic
1163002722 19:14378793-14378815 GATTCCAGGTGAGCACAACCAGG - Intergenic
1163687379 19:18719428-18719450 GGTACCAGGTGGGCCCCGGCAGG + Intronic
1164575730 19:29404367-29404389 CGTTCTAGGTGAGCAAAGGCTGG + Intergenic
1164728037 19:30479949-30479971 GGTTCCAAGGGAGCCCGCGCTGG + Intronic
1165036366 19:33036692-33036714 AGTTCCAGGTGGGCGTGGGCTGG + Intronic
1166305078 19:41932806-41932828 GGAGCCAGGAGAGCACGGGGAGG + Intergenic
1167339382 19:48905878-48905900 GGATCCCAGTGAGCAGGGGCAGG + Exonic
1167383636 19:49151989-49152011 CGCTCCAGGTGAGCATGGGCGGG - Exonic
1167433090 19:49464416-49464438 GGCTCCAGGTGGGCACTGTCTGG + Exonic
1167505176 19:49867454-49867476 GGTCCCGGGTGAGTACGGGGCGG - Exonic
1168129606 19:54309947-54309969 GCCTCCAGGTGAGCACAGGAGGG + Intronic
1168169791 19:54577637-54577659 GCCTCCAGGTGAGCACAGGAGGG - Intronic
926801653 2:16665325-16665347 GGGTCCAGGTGTGCAGGGGCTGG + Intronic
927137369 2:20106812-20106834 GGTTCCAGGTGAGCGCCGGCTGG - Intergenic
927357056 2:22186396-22186418 AGTTCCGGGTGAGCGTGGGCTGG + Intergenic
927846205 2:26473999-26474021 GGTACTTGCTGAGCACGGGCCGG + Exonic
928036884 2:27832732-27832754 GGATCCAGGTCAGCAATGGCAGG + Exonic
933727881 2:85436758-85436780 GGCTCTAGGTGAGCATGGGGTGG - Intronic
933876181 2:86623551-86623573 GGCTCCAGGTTCGCTCGGGCCGG + Exonic
937110933 2:119366835-119366857 GGTCCCACGTGGGCTCGGGCGGG + Intergenic
938139984 2:128787398-128787420 GGTGCCAGGGGTGCACTGGCTGG - Intergenic
941104927 2:161341196-161341218 GGTTCCGGGGGCGCGCGGGCAGG + Intronic
944688228 2:202136642-202136664 GGTTCCGGGTGGGCGCGGACTGG - Intronic
946432180 2:219631754-219631776 GGTCCCAGGTGACCATGGGGAGG + Intronic
948301680 2:236912334-236912356 GGGGCCAGGTGAGCAGGGCCAGG - Intergenic
1169226073 20:3857818-3857840 GGGTCCAGGAGGGCAAGGGCAGG - Intronic
1169440185 20:5627296-5627318 GGATGCAGGTGAGCAGGTGCAGG - Intergenic
1170804043 20:19614433-19614455 GCTTCCAGGAGAGGATGGGCTGG - Intronic
1173274978 20:41572552-41572574 GGTTCCAGATGAGCCAGGCCTGG - Intronic
1173849792 20:46210521-46210543 GGATCACGGTGTGCACGGGCTGG + Exonic
1175221589 20:57420525-57420547 GGTTGGAGGTGACCAGGGGCAGG + Intergenic
1175283358 20:57820217-57820239 GGTTCCTGGTGACCCTGGGCAGG - Intergenic
1175530210 20:59669642-59669664 GGTTACAGGTGGCCAGGGGCCGG - Intronic
1178291493 21:31372462-31372484 GGTTCCGGCTGAGCAGGGGTTGG - Intronic
1179715120 21:43282403-43282425 GTTTCCAGGTGGGCAGAGGCGGG + Intergenic
1180594192 22:16962918-16962940 AGTTCCTGGTGAGGAAGGGCAGG + Intronic
1180955527 22:19739648-19739670 GCTTCCAGGGGACCACCGGCTGG - Intergenic
1181063249 22:20292002-20292024 GGCACCAGGTGAGCCCGGGCTGG - Intergenic
1181124699 22:20695247-20695269 GGGTGCGGGTGAGCACAGGCAGG - Intergenic
1181650649 22:24257209-24257231 GGTTGTGGGTGAGCACAGGCAGG - Intergenic
1183442025 22:37828559-37828581 GTTTGCAGGTGGGCAAGGGCAGG + Intergenic
1184043348 22:41957528-41957550 AGGTCCAGGAGAGCAAGGGCGGG - Intergenic
1184955812 22:47885318-47885340 TGTTCCAGGTGGGCAGGGGGCGG - Intergenic
1185108292 22:48886487-48886509 GGCTCCAGGAGAGCAAGGGCTGG - Intergenic
1185394209 22:50578464-50578486 GGTTCCTGGTGAGGGCGGGGCGG - Intronic
950136809 3:10586877-10586899 GGTGCCATGTGAGCAGGGACCGG - Intronic
950421554 3:12902578-12902600 GGTTCCAGGCAGGCAGGGGCAGG + Intronic
952090441 3:29878496-29878518 GGGTCAAGGTGAGAATGGGCAGG - Intronic
956129204 3:66038576-66038598 TGGTCCGGGAGAGCACGGGCGGG - Intronic
961786400 3:129349727-129349749 GGTTCTAGGTGAGCTGGGGCGGG + Intergenic
969657705 4:8507684-8507706 GCCTCCAGGTGACCAGGGGCAGG - Intergenic
971281706 4:25246922-25246944 AGTTCCAGGTGGGCATGGGCTGG - Intronic
977588770 4:98803818-98803840 GGTTCCTGGTGGGCCCAGGCAGG - Intergenic
984795052 4:183652410-183652432 GGGTCCAGCTGATCACGGGGCGG + Intronic
990333157 5:54746807-54746829 GGGTCCAGGTTGGAACGGGCAGG - Intergenic
993068910 5:83134003-83134025 GGTTCCAGGTGAGCACGGGCTGG + Intronic
993376177 5:87151257-87151279 AGTTCCAGGAGAGCACAGACAGG - Intergenic
994082144 5:95718867-95718889 GGTCCCAGGAGAGCACAAGCAGG + Intronic
996881422 5:128300890-128300912 GGTACCAGGAGAGCAAGAGCCGG + Exonic
999230281 5:150057669-150057691 GGTTCCAGTTGACCATGGGGTGG - Intronic
1002421165 5:179149812-179149834 GGTTCCCGAGGAGCACAGGCTGG - Intronic
1002442822 5:179273179-179273201 GGTTCAAGCTGAGCACCAGCTGG - Intronic
1002697371 5:181099915-181099937 GGTGCCAGGTGAGGACTGGGTGG + Intergenic
1002932139 6:1642064-1642086 GGTTCCAAGTGAGCGAGGACAGG - Intronic
1003516415 6:6822450-6822472 GTTTCCAGGTGAGGACAGCCAGG - Intergenic
1004441880 6:15662395-15662417 AGCTCCAGGTGCGCACGAGCAGG + Intronic
1005593783 6:27357528-27357550 TGTTCCAGCTGAGAAGGGGCTGG - Intergenic
1007108238 6:39297861-39297883 GGTCCGAGGTGAGCTCGGGTTGG + Intergenic
1007395618 6:41576029-41576051 GGTTGCGGGTGAGGAAGGGCAGG - Intronic
1013168937 6:107618972-107618994 GATTAGAGGTGAGCAGGGGCGGG + Intronic
1013404125 6:109827666-109827688 GGTACCAGGTTAGCAAGTGCTGG - Intergenic
1016182802 6:141168178-141168200 GGTTCCAAGTGAGCGCGGGCTGG + Intergenic
1018386237 6:163305849-163305871 GGTTCCAGGTGAGTAAGTGATGG - Intronic
1018734815 6:166679813-166679835 GGTTCCAGGTGAGCGCGGCTCGG + Intronic
1019194434 6:170272863-170272885 GGTTAGAGGTGAGCTGGGGCCGG + Intergenic
1019626940 7:2020586-2020608 GGTACCAGGGCAGCCCGGGCAGG - Intronic
1019728744 7:2617871-2617893 GGGGCCTGGTGAGAACGGGCAGG - Intergenic
1024526414 7:50353599-50353621 GCTTCCAGGTGAGCTCAGGTGGG + Intronic
1026670762 7:72388802-72388824 GGTCGCAGGTGTGCACTGGCTGG + Intronic
1027926776 7:84475100-84475122 GGTCCCAGGAGTGCAGGGGCTGG + Intronic
1035232907 7:157477032-157477054 GGTTCCGGATGACCACAGGCTGG + Intergenic
1035232912 7:157477053-157477075 GGTTCCGGATGACCACAGGCTGG + Intergenic
1035698961 8:1623351-1623373 GGTTCCAGGTCATCACGCACAGG - Intronic
1036604844 8:10295692-10295714 GGTGCCAAGTGACCACAGGCTGG - Intronic
1041145862 8:54875274-54875296 GGTTCCGGGTGGGCGCGGGCTGG + Intergenic
1045479627 8:102581657-102581679 GGATCCAGGTGGACACTGGCAGG + Intergenic
1048271515 8:133032020-133032042 AGCTCCAGCTGAGCAGGGGCTGG + Intronic
1049107612 8:140623635-140623657 GGTAACAGGTGTGCACGGGAGGG - Intronic
1049225261 8:141447707-141447729 GGTTTCAGGGGAGCACGCCCTGG + Intergenic
1049254146 8:141605006-141605028 GGTGGCAGGTGAGCCCAGGCCGG + Intergenic
1049574096 8:143382531-143382553 GGCTCCAGTTGAGGAGGGGCCGG - Exonic
1049755669 8:144310321-144310343 GGGTCCCGGTGAGGAGGGGCTGG - Intronic
1049796774 8:144500605-144500627 GGGGCCAGGTGAGTGCGGGCGGG + Exonic
1051334970 9:16057845-16057867 GGCTGCAGGTTAGCAGGGGCTGG + Intronic
1051369777 9:16348523-16348545 GGTTCCAAGTGGGCATGGGTGGG + Intergenic
1055462086 9:76528828-76528850 GGTTCCAGGTGGGCGCGGGCTGG - Intergenic
1056618983 9:88194649-88194671 GGTTACAGGTGTGCACCGCCAGG - Intergenic
1056968118 9:91180800-91180822 GGTCCCTGCTGAGCCCGGGCTGG - Intergenic
1058247922 9:102654079-102654101 GGTTCTGGGTGACCACTGGCTGG + Intergenic
1060157409 9:121329246-121329268 GGTTCCTGGTGAGCTCATGCAGG + Exonic
1060765676 9:126293697-126293719 GGCTCCCCGTGAGCAGGGGCTGG - Intergenic
1060814263 9:126626532-126626554 GGCTCCAGGAGAGGACGGGCGGG - Intronic
1061391010 9:130316972-130316994 GGCTCCAGGTTAGCAGGGGGAGG + Intronic
1061791912 9:133063503-133063525 GGTTCCAGGTGGGGAAGGGCAGG - Intronic
1061997438 9:134193609-134193631 GGTCCAAGGTGAGCACGGTGAGG + Intergenic
1062052275 9:134453802-134453824 GGCCCCAGGTGAGCACTGGCCGG + Intergenic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1062532953 9:137009706-137009728 ACTTCCTGGTGAGCACGGGCAGG - Intronic
1191927478 X:66329168-66329190 GGTTCCAGGTGAGCATGGGCTGG + Intergenic
1194620347 X:96163125-96163147 GGATTCAGGTGAGCAGGTGCAGG - Intergenic