ID: 993070907

View in Genome Browser
Species Human (GRCh38)
Location 5:83162297-83162319
Sequence CAGGGTAACCAACTTTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993070907 Original CRISPR CAGGGTAACCAACTTTAAGA GGG (reversed) Intronic
908574476 1:65444551-65444573 CAGATTAACAAACTTTCAGAAGG + Intronic
911878093 1:103195610-103195632 CAGGTTTGCCAACTTTAATAAGG + Intergenic
917412762 1:174776702-174776724 CAGGGTAACCACCATTAAAATGG - Intronic
922197973 1:223376183-223376205 CAGTGTAAACAGATTTAAGATGG - Intergenic
1072185383 10:93032858-93032880 CAGGGAAACCCTCTTTAAGGCGG + Intronic
1075615353 10:123886890-123886912 CAGGGTCATCAATTTGAAGATGG + Intronic
1075961360 10:126569822-126569844 CAGGGTAACAAAGTTTACAAGGG + Intronic
1077483811 11:2829869-2829891 AAGGGTAAGAAAATTTAAGAAGG + Intronic
1090066132 11:123505071-123505093 CAGGGTGTCCGACATTAAGAGGG - Intergenic
1090535920 11:127641541-127641563 TAGGGTAAACAAATTTAAGCTGG + Intergenic
1092816878 12:12320061-12320083 CAGGGTAAAATGCTTTAAGATGG - Intergenic
1094675302 12:32613962-32613984 ATGGGTAACTAATTTTAAGAAGG + Intronic
1096263824 12:50108802-50108824 CAGTGTCACCAACTGTAAAATGG - Intronic
1097054469 12:56241456-56241478 CAGGGTATACAACTAAAAGATGG + Exonic
1098816606 12:75172890-75172912 GATGGGAACCAACTTTAACAAGG + Intronic
1099705310 12:86145089-86145111 CAGGGTATACAACTTTTAAATGG + Intronic
1101241931 12:102847755-102847777 CAGGGTAAGCATCATTGAGAAGG + Intronic
1105046241 12:133006172-133006194 CAGGGCAACCCAGTCTAAGATGG - Intronic
1105949636 13:25218021-25218043 CAGGGTATCCCACAATAAGATGG + Intergenic
1106399499 13:29415363-29415385 CACAGTAGCCAACTTTATGAAGG - Intronic
1118162691 14:63306460-63306482 CAGGTTATCCAAAGTTAAGACGG + Intergenic
1128615738 15:69107709-69107731 CAGGGCAATCAACTTTAAATTGG + Intergenic
1130712629 15:86298849-86298871 CAGGGGAACCAGCCTTGAGAGGG - Intronic
1130846136 15:87748030-87748052 CAGGATAACTAACTCTAGGAAGG + Intergenic
1133931757 16:10238547-10238569 CAGGGAAAGCATCTTTCAGAGGG - Intergenic
1134057449 16:11179611-11179633 CAGTGTTACCATCTCTAAGAAGG + Exonic
1135270152 16:21062291-21062313 CAGTGTACCCATCTCTAAGATGG - Intronic
1135840853 16:25874873-25874895 CAGGCTAACTAACTTGAACAAGG - Intronic
1139629414 16:68219602-68219624 CTGGGTAAACAATTTTATGAAGG - Intronic
1143986194 17:10916490-10916512 CAGGTTAATCAACATAAAGAGGG + Intergenic
1147572787 17:41581707-41581729 TAGGTTAACCAAGTGTAAGAAGG + Intergenic
1148055271 17:44790692-44790714 CTGGGTAACTAAATTTAATATGG + Intergenic
1148450538 17:47774909-47774931 CACTCAAACCAACTTTAAGAGGG - Intergenic
1153535234 18:6095244-6095266 CAGTGTAAGCAACTTTACCAAGG + Intronic
1154241786 18:12658770-12658792 CAGGGTAAGCACCGTAAAGACGG + Exonic
1156104071 18:33635723-33635745 CAGGGTATGCAAATATAAGATGG + Intronic
1156628102 18:38934102-38934124 CAGGGTGACCATCTCTAATAAGG + Intergenic
1161376914 19:3944173-3944195 CAGGGTAACCAACCAAAAAACGG + Intergenic
1162322817 19:9979873-9979895 CAGGGTCACCAAGGTAAAGATGG - Exonic
1165705812 19:37975494-37975516 CAGGGTCCCCATCTGTAAGATGG + Intronic
927736688 2:25530034-25530056 AAAGGTAACCAACTTAAAAATGG + Intronic
929244714 2:39688601-39688623 CAGGCTATCTAACTGTAAGAGGG + Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930693932 2:54391885-54391907 CAGGGTAATGAACTGTAACAAGG + Intergenic
932314692 2:70772086-70772108 TAGGGGAACCCACTTTAAGATGG + Intergenic
933523170 2:83400983-83401005 CATGTTAACCACCTTTAAAACGG - Intergenic
944199141 2:197086758-197086780 CAGGGAAAACATCATTAAGATGG + Intronic
1174905845 20:54550130-54550152 CAGAGTGAGTAACTTTAAGAAGG - Intronic
1177640357 21:23836831-23836853 CAGTGTAACCAAGTTCAAAATGG + Intergenic
1178073062 21:28990712-28990734 CAGGCTAAACAATTTTTAGAAGG - Intronic
1179086884 21:38226085-38226107 TAGGGGAACTAACTTTAAGAAGG - Intronic
1185201557 22:49509164-49509186 CAGGGTATCCAGCTTGCAGACGG - Intronic
949485155 3:4531076-4531098 CAGGGTGCCCAACTGTAAAATGG - Intronic
949903294 3:8837713-8837735 AAGGGTAAGCAGGTTTAAGATGG + Intronic
952157728 3:30661357-30661379 GAGGGCAACCAACATTAGGAGGG - Intronic
956011249 3:64833980-64834002 CAGAGTAATCAACTTTAAAATGG + Intergenic
956485531 3:69718287-69718309 CAAGTTCACCAACTTTAAAATGG + Intergenic
956760746 3:72441943-72441965 CAGGGTATCTAAATTTAAGGGGG + Intronic
957271520 3:78036588-78036610 CAGGGTATACAACTTGAAGGAGG + Intergenic
960442192 3:117702485-117702507 CAAGGCAACCAACTTTCACATGG - Intergenic
964666922 3:159184838-159184860 CAGGTTTACTAAATTTAAGAGGG + Intronic
966925327 3:184640836-184640858 CTTAGCAACCAACTTTAAGATGG - Intronic
972272539 4:37524968-37524990 CAGGGTGTCCAGATTTAAGATGG + Intronic
975127245 4:70796737-70796759 AAGGATAACTCACTTTAAGAAGG - Intronic
975285808 4:72618136-72618158 CAGGGAAAGCAAAATTAAGAGGG + Intergenic
978315575 4:107432836-107432858 CAGGGAAAGCAAATTTGAGATGG - Intergenic
987225484 5:15836104-15836126 CAGGGTAAACAAAATTCAGATGG + Intronic
987785037 5:22488733-22488755 CAGGGTAAGCAGGTTTAGGATGG - Intronic
992086704 5:73284180-73284202 CAGGTTAACATACTTTAGGATGG + Intergenic
992489217 5:77225164-77225186 CAGGATAACCAACTATTGGATGG - Intronic
993070907 5:83162297-83162319 CAGGGTAACCAACTTTAAGAGGG - Intronic
993610381 5:90046363-90046385 CAGGGTTAACAGCTTTAAGTAGG - Intergenic
994167160 5:96619722-96619744 CAGGCACACCATCTTTAAGAAGG + Intronic
995896482 5:117017964-117017986 CAGAGAAAAGAACTTTAAGAAGG + Intergenic
1000585420 5:163091572-163091594 CAGGGAAAACAACTTTATCAAGG - Intergenic
1004295389 6:14405424-14405446 CAGGGTAACCAACTCTCCGTGGG - Intergenic
1009919544 6:70040289-70040311 GAGGGTGACCAAGTTTAAAAAGG + Intronic
1010509097 6:76695496-76695518 CAGTGTAAACAAGTTTAAGTAGG - Intergenic
1014739191 6:125127116-125127138 CAGGTTATCCAAAGTTAAGATGG + Intronic
1015954458 6:138585599-138585621 CAGTGAAACAAACTTTAGGATGG - Intronic
1017162833 6:151381641-151381663 CAGAGTAAGCAACTATTAGATGG - Intronic
1019771453 7:2886235-2886257 CAGGGTTTCCAACTATAAAATGG - Intergenic
1019939463 7:4277726-4277748 CAGGGTTATGAATTTTAAGAAGG - Intergenic
1021481099 7:21118103-21118125 CAGGTTATCCAAAGTTAAGACGG - Intergenic
1026027672 7:66760418-66760440 CATGCTAACCAACTTTACAAGGG - Intronic
1029862060 7:103583253-103583275 CAGGGTCTCCAACTTGCAGATGG + Intronic
1031024784 7:116668522-116668544 TAGGGTAAGCAAAGTTAAGAAGG + Intergenic
1032102610 7:128995325-128995347 CAGAGTTACCAATTATAAGATGG + Intronic
1032746451 7:134791515-134791537 CTCAGTAACCAACTTTATGAAGG + Intronic
1032783116 7:135179975-135179997 TAGGGGAACTAACTTTAAAAAGG + Intergenic
1037455249 8:19057064-19057086 AAGGGGAACCAGTTTTAAGAAGG - Intronic
1040861397 8:52002800-52002822 CAGGGCAACCAATTATAAGAAGG - Intergenic
1043333223 8:79142535-79142557 CAGCGTACCCAGCTTGAAGATGG + Intergenic
1045560098 8:103253530-103253552 CAGGCTAACCAACTCTAAGAGGG - Intergenic
1046181357 8:110653373-110653395 TAGGGCAACCTACTTGAAGAAGG - Intergenic
1048122104 8:131593173-131593195 ATGGGTAGCCCACTTTAAGAAGG - Intergenic
1048607534 8:135985105-135985127 GAGGGTAATCAGCTTTTAGAGGG - Intergenic
1050751082 9:8938142-8938164 CAGGGTAACCAATTTGTTGATGG + Intronic
1051689448 9:19694906-19694928 CAGGGAAATCAACTTGATGAGGG - Intronic
1051689628 9:19696386-19696408 CAGGGAAATCAACTTGATGAGGG + Intronic
1055217837 9:73888516-73888538 AAGGGTAACCATTTTTAAGCTGG + Intergenic
1055989872 9:82094116-82094138 CAGAGTAACAATCTATAAGAGGG - Intergenic
1057042127 9:91855565-91855587 CAGGGTAAGCATCTTAGAGAAGG + Intronic
1057586058 9:96329959-96329981 CAGGGTCTCCAACTTGCAGATGG - Intronic
1058778785 9:108312197-108312219 CAGGGTAAGCAAGTTCAACACGG + Intergenic
1059032283 9:110711655-110711677 CAGTGGAACAAACTTAAAGAAGG + Intronic
1187874482 X:23792799-23792821 CAAGGTAACAAAATGTAAGATGG - Intergenic
1188281240 X:28272373-28272395 CTGGGTCACAGACTTTAAGATGG + Intergenic
1189344778 X:40232678-40232700 CAGGGTAACTAACTTATAGCGGG - Intergenic
1193373442 X:80727803-80727825 CAGGGTAACCAAATTTGATATGG - Intronic
1195121884 X:101762817-101762839 CAGGGGAACCAAATATAATAAGG + Intergenic
1195743337 X:108089277-108089299 CAGGGTAAGCAACTTGTGGACGG + Intronic
1198282327 X:135154336-135154358 CAGGGCACCCAAGTTTAGGAAGG + Intergenic
1198284616 X:135177309-135177331 CAGGGCACCCAAGTTTAGGAAGG + Intergenic
1198287000 X:135200770-135200792 CAGGGCACCCAAGTTTAGGAAGG + Intergenic
1198288632 X:135218186-135218208 CAGGGCACCCAAGTTTAGGAAGG - Intergenic
1201858373 Y:18569814-18569836 TAGGGAAATTAACTTTAAGAAGG - Intronic
1201874948 Y:18750567-18750589 TAGGGAAATTAACTTTAAGAAGG + Intronic
1202052008 Y:20791170-20791192 TAGGAGAACTAACTTTAAGAAGG - Intergenic