ID: 993071510

View in Genome Browser
Species Human (GRCh38)
Location 5:83170247-83170269
Sequence GGAGTTGGACAGTTACAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993071510 Original CRISPR GGAGTTGGACAGTTACAACT AGG (reversed) Intronic
902891499 1:19447647-19447669 TGAGTTGCACAGATACACCTGGG + Intronic
907653544 1:56319725-56319747 GGGATTGGAAAATTACAACTGGG - Intergenic
910057037 1:83045636-83045658 GGAATTGGGCACTTACTACTGGG - Intergenic
910846858 1:91612196-91612218 GGAGTTGGTCAGTAGAAACTAGG + Intergenic
914884388 1:151573372-151573394 GGAGTTGGAAAGATGCAAGTTGG + Intronic
915016594 1:152739886-152739908 GGACTAGGACAGTTAAGACTTGG - Intronic
923356196 1:233158191-233158213 GGAGTGGGCCATTAACAACTCGG - Intronic
1063828247 10:9923245-9923267 GGACTTGGACATTTAAAAATCGG + Intergenic
1064395799 10:14981152-14981174 AGAGTTGGCCAGTTAAGACTGGG - Intronic
1068878812 10:62027203-62027225 GGAGTTGGACAGATTCAAGGAGG - Intronic
1069492004 10:68868998-68869020 GGAGTTGGTCAGGTAGACCTGGG - Intronic
1072816883 10:98518136-98518158 GGAGTTGGTCAGAAGCAACTTGG + Intronic
1073884958 10:108027712-108027734 GGAGTTGGTCAGTTTCATCTAGG - Intergenic
1075236982 10:120739350-120739372 GAGGTTGGACAGTCTCAACTGGG + Intergenic
1081473288 11:43397856-43397878 GGATTTGGACAGATGCAACCAGG + Intronic
1082115476 11:48323782-48323804 GGAGTTGGACAATAAGAAGTAGG + Intergenic
1086764790 11:90682343-90682365 AGAGTTGAATAGTTACTACTAGG - Intergenic
1086944937 11:92835750-92835772 AGAGTTGGGCAGCTACAATTTGG + Intronic
1093666973 12:21825916-21825938 GGCTTTGGAAAGTTAAAACTAGG + Intronic
1099847564 12:88047445-88047467 GGACTCAGAGAGTTACAACTAGG - Intronic
1101127882 12:101657588-101657610 GGAGTTGGTCCATTTCAACTAGG - Intronic
1101394704 12:104335850-104335872 GCAGTAGGACAGTTACAGGTTGG + Intronic
1102697035 12:114808049-114808071 GGAGGTGGACAGTTTAAAATGGG - Intergenic
1103083172 12:118041532-118041554 GGAGCTGGACAGTCATAGCTTGG + Intronic
1109368980 13:61396968-61396990 TCAGATGGACAGTTACAACAGGG + Intergenic
1109414268 13:62015614-62015636 GGGCTTGTACAGTTACAAATAGG - Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1113054726 13:106255848-106255870 GGAGAAGGACATTTACAAATGGG - Intergenic
1116574783 14:46558856-46558878 GGAGTTGGAAAATTACAGCCTGG + Intergenic
1117269847 14:54132142-54132164 GGAGTTGGTCAGTCAAAAGTTGG - Intergenic
1121351100 14:93173639-93173661 GCAGCTGGACATTTACAGCTTGG + Intergenic
1122936356 14:104958591-104958613 GGAGTTGAAAATTTACTACTGGG + Intronic
1125289232 15:38127381-38127403 GGAGATGGATAGTCACCACTGGG - Intergenic
1133283199 16:4678645-4678667 GGAGTTGGACAGTGACTGGTTGG + Intronic
1133312569 16:4859605-4859627 GTAGTTTGAAAGTTACAAGTGGG - Intronic
1136399476 16:30009970-30009992 GGAGGTGGACAGCTATGACTCGG - Exonic
1143484498 17:7246104-7246126 GGAGTTGGGCAGCTACATCAAGG - Exonic
1145997866 17:29114906-29114928 GGAGTTGGAAAGATACAAGGAGG - Exonic
1148581895 17:48749994-48750016 GGAGTGGGACAGTAAGGACTAGG + Intergenic
1149673138 17:58433598-58433620 AGAGTTGGCCAGTGAAAACTAGG + Intronic
1153552062 18:6272401-6272423 GGAGTTGTGCAGATTCAACTAGG + Intronic
1153552079 18:6272518-6272540 GGAGTTGTGCAGATTCAACTAGG + Intronic
1153552128 18:6272869-6272891 GGAGTTGTGCAGATTCAACTAGG + Intronic
1158362242 18:56688138-56688160 GGAGTTGCTGAGTTACAACATGG + Intronic
1161845375 19:6709143-6709165 AGAATTGGACACTTTCAACTGGG - Intronic
1164644588 19:29848978-29849000 GGACCTGGACAGGTAGAACTTGG + Intergenic
1166838478 19:45681914-45681936 GGAGTTGGAAAGTTACTGCTAGG + Exonic
925586175 2:5466487-5466509 GGAGTTAGACAGTGTAAACTTGG - Intergenic
925980728 2:9174938-9174960 GGATTTGGAGTGTCACAACTGGG - Intergenic
926474430 2:13304716-13304738 GTAATTGGACATTTACAGCTTGG - Intergenic
931298447 2:60953215-60953237 TGAATTGTACAGTTAAAACTGGG - Intronic
932386256 2:71335832-71335854 GGAGGTAGTGAGTTACAACTGGG - Intronic
934941703 2:98507652-98507674 GGAGCTGGAGAGTTTCAAGTTGG + Intronic
938030364 2:127987061-127987083 GAAATTGGACAGTTAGAACATGG - Intronic
941168772 2:162112084-162112106 TCAGCTGGACAGTTCCAACTTGG - Intergenic
942168259 2:173264031-173264053 GGAGTAAGCCAGTTGCAACTGGG - Intronic
946066464 2:216991673-216991695 GGAGATAGACACTTACAGCTGGG - Intergenic
947781629 2:232770962-232770984 GCACTTGGACAGTCACCACTGGG + Exonic
1169129007 20:3153663-3153685 GGAGCTGGAGGGTTAGAACTAGG + Intronic
1170869057 20:20188020-20188042 GGACTTAGACCGTTACAACAAGG + Exonic
1171039092 20:21743090-21743112 GGAGTTGGACTGTTCCATCATGG + Intergenic
1171466193 20:25329418-25329440 GGGGGTGGACAGTGAAAACTGGG - Intronic
1173791201 20:45828811-45828833 GCAGATGGACAGTGGCAACTGGG + Intronic
1174419345 20:50389633-50389655 GGAGTTGCCCAGTTAGAACTTGG - Intergenic
1182967959 22:34540658-34540680 GGAGTTGGGGAGTTACCAATGGG - Intergenic
949335346 3:2968762-2968784 GGAGGTGGACAGTTATAATCAGG + Intronic
950272154 3:11625964-11625986 AGAGTTGTACAGTTATCACTGGG - Intronic
952100090 3:30000826-30000848 GGAGTTGAACAGTGAGAACATGG + Intronic
952240041 3:31522096-31522118 GGAGTTGAACAGTTATATTTGGG - Intergenic
956958861 3:74374477-74374499 GGAGAGGGACAGTTACTCCTAGG - Intronic
959148400 3:102577607-102577629 GGAGATGGACAGTTTCTGCTTGG + Intergenic
960513657 3:118579418-118579440 AGAGTTGGACAGTTGCAACAGGG - Intergenic
968535059 4:1120495-1120517 GGAATTGGTCAGTTTCACCTAGG - Intergenic
970529145 4:16964566-16964588 AGAGTTGGACAGATACACCATGG - Intergenic
970949167 4:21732560-21732582 AGAGTTGCACAGCCACAACTTGG + Intronic
973115726 4:46455947-46455969 GGTGTTGGACCGTTACTGCTTGG - Intronic
973998526 4:56485306-56485328 AAAGTTGGACAGGTACAATTAGG + Intronic
975229620 4:71916755-71916777 GGAGATGGGTAGTTACTACTGGG - Intergenic
977111270 4:92958913-92958935 GGAGTAGGTCTGTTTCAACTAGG + Intronic
979789270 4:124757752-124757774 GAAGTTGGGCAGATACAATTAGG - Intergenic
986587439 5:9333335-9333357 GCTGTTGGACATTTACAAATTGG - Intronic
992056668 5:72997399-72997421 GGAGTTGGGCAGCTACATCAAGG + Intronic
993071510 5:83170247-83170269 GGAGTTGGACAGTTACAACTAGG - Intronic
996506170 5:124269925-124269947 GGACTAGGACAGTAACAACTAGG - Intergenic
1000789600 5:165589224-165589246 GGAGCTGGGCAGATAAAACTTGG + Intergenic
1005163425 6:22892159-22892181 GGAGTTAGTCAGTGACAACTTGG - Intergenic
1007525278 6:42487157-42487179 GGAGTTGGAGAGGTACACATAGG - Intergenic
1007935629 6:45729663-45729685 GGATTTTGACAGGTCCAACTGGG - Intergenic
1008252299 6:49254876-49254898 GGAGTAGTACAGTTGCAACAAGG - Intergenic
1010492477 6:76492423-76492445 GTTTCTGGACAGTTACAACTTGG - Intergenic
1015153372 6:130063376-130063398 GGAGTTGGACAGGACCATCTAGG + Intronic
1015365946 6:132398483-132398505 AGAGTTGGACAATTACACCAGGG - Intronic
1021253978 7:18366719-18366741 GTAGTTGCAGAGTTATAACTTGG + Intronic
1025251603 7:57354850-57354872 GGAGTTGCCCAATTAGAACTTGG + Intergenic
1027544351 7:79507687-79507709 GGAAATGCACAGTTACACCTTGG + Intergenic
1028271351 7:88794318-88794340 GGAGTAGGTCAGGTGCAACTTGG + Exonic
1028742378 7:94290503-94290525 GGAGTTGGACAGATACCCCATGG - Intergenic
1033435757 7:141332051-141332073 GAAGATGGACAGTCACAACCAGG - Intronic
1035978908 8:4346392-4346414 CGAGTTGAACAGTTACATCAGGG + Intronic
1041102640 8:54412094-54412116 GGAGTTGGAGATTTACTACATGG - Intergenic
1041104221 8:54425645-54425667 GGAATTGTACAGTATCAACTTGG - Intergenic
1041392109 8:57356133-57356155 AGAGCTGGATAGTTAAAACTTGG - Intergenic
1042130137 8:65579847-65579869 GGAGTTGAACAGTGAGAACATGG + Intergenic
1044759828 8:95506543-95506565 GGAGTTGGACGTGGACAACTTGG + Intergenic
1050758945 9:9042362-9042384 GGACTAGGACAATTCCAACTGGG + Intronic
1051146356 9:14031748-14031770 TGAATTGGTCAGTGACAACTGGG - Intergenic
1052092381 9:24344834-24344856 GGAGTTGGAAAGTTAAATGTAGG + Intergenic
1055110376 9:72553468-72553490 AGAGTAGAACAGCTACAACTGGG - Intronic
1055499689 9:76890488-76890510 GGAGTTGGACAACTAAAAATTGG + Intronic
1058621227 9:106885520-106885542 GGAGTTGGACACTACCTACTAGG + Intronic
1060684298 9:125594281-125594303 GGAGTTGGAATGCTACCACTAGG - Intronic
1203614606 Un_KI270749v1:47532-47554 GGTTTTGGAAAGTTGCAACTGGG + Intergenic
1189852825 X:45193947-45193969 GGAGCTGGAAAGTTATCACTAGG + Intronic
1197961855 X:132015790-132015812 GGAAGTGAACAGTTCCAACTTGG + Intergenic
1198151888 X:133919247-133919269 GGAGTTGGAGAGCACCAACTTGG - Intronic