ID: 993073841

View in Genome Browser
Species Human (GRCh38)
Location 5:83201382-83201404
Sequence GCATTTTACTAGGGGCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993073841_993073855 27 Left 993073841 5:83201382-83201404 CCCACTGGCCCCTAGTAAAATGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 993073855 5:83201432-83201454 AGCTGGTAGGGGCTTCAGCTTGG 0: 1
1: 0
2: 2
3: 20
4: 184
993073841_993073852 15 Left 993073841 5:83201382-83201404 CCCACTGGCCCCTAGTAAAATGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 993073852 5:83201420-83201442 ACACCAAGTACAAGCTGGTAGGG 0: 1
1: 0
2: 1
3: 12
4: 203
993073841_993073851 14 Left 993073841 5:83201382-83201404 CCCACTGGCCCCTAGTAAAATGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 993073851 5:83201419-83201441 CACACCAAGTACAAGCTGGTAGG 0: 1
1: 0
2: 0
3: 14
4: 98
993073841_993073853 16 Left 993073841 5:83201382-83201404 CCCACTGGCCCCTAGTAAAATGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 993073853 5:83201421-83201443 CACCAAGTACAAGCTGGTAGGGG 0: 1
1: 0
2: 1
3: 4
4: 155
993073841_993073850 10 Left 993073841 5:83201382-83201404 CCCACTGGCCCCTAGTAAAATGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 993073850 5:83201415-83201437 GTTTCACACCAAGTACAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993073841 Original CRISPR GCATTTTACTAGGGGCCAGT GGG (reversed) Intronic
900570794 1:3357324-3357346 GCATTTAACAAGAGGCCACTAGG - Intronic
903360259 1:22772541-22772563 GCATTCTTCTAGGAGCTAGTCGG + Intronic
907529790 1:55083284-55083306 GCTTCCTCCTAGGGGCCAGTCGG - Exonic
913459492 1:119068935-119068957 GCACATGACTAGAGGCCAGTGGG + Intronic
916622862 1:166519921-166519943 GCATTTTTCTAGGGGCTGCTAGG + Intergenic
922396294 1:225204700-225204722 ACACTTTACTATGTGCCAGTGGG + Intronic
1066307955 10:34165471-34165493 GCATTTTGCAAGGTGCCACTGGG + Intronic
1069065715 10:63939683-63939705 GCATTGATCTAGGAGCCAGTAGG + Intergenic
1075412736 10:122240924-122240946 GAAGTTTACTCTGGGCCAGTAGG + Intronic
1080820486 11:35801217-35801239 GCATTGTACAAGGAGCCAATTGG - Intronic
1085466338 11:76726124-76726146 GCCTTATACTAGGGGCCAAGTGG - Intergenic
1093796202 12:23315358-23315380 GCACTATACTTGGGACCAGTGGG - Intergenic
1095515976 12:43005935-43005957 TCATTTTACTTGGGGTCATTGGG + Intergenic
1103058080 12:117837136-117837158 GCCGTTCACTAGGGGCCAGCCGG + Intronic
1107523339 13:41204926-41204948 GCATTTTACGAGGGGGCTGGGGG + Intergenic
1108679299 13:52765558-52765580 GAATTTTCCTAAGGTCCAGTAGG - Intergenic
1110081259 13:71316144-71316166 GTATTTTACTAGGAGCCACTTGG + Intergenic
1111842802 13:93472270-93472292 GCATTTTCCTAGGGCCCACAGGG + Intronic
1115872179 14:37816942-37816964 GCCTCTTCCTAGGGGCCACTGGG + Intronic
1117049932 14:51849721-51849743 GAAGTTTACTAGGTGCCAGAAGG - Intronic
1121336649 14:93081858-93081880 GCCTTTACCTATGGGCCAGTGGG + Intronic
1122217869 14:100215689-100215711 ACATTTTATCAGGGGACAGTGGG + Intergenic
1123993489 15:25702090-25702112 GCATTTGACCAGGTGCCACTGGG - Exonic
1125405467 15:39348901-39348923 GCAGTTTAACTGGGGCCAGTGGG + Intergenic
1130674883 15:85942798-85942820 GCATTTTACTACAGCCCGGTAGG - Intergenic
1131536869 15:93245068-93245090 GCACTTTTCTAGGTGCCAGAGGG + Intergenic
1133961772 16:10501153-10501175 GCATTTAAAAAGGGCCCAGTGGG + Intergenic
1143383535 17:6510948-6510970 CCATTTGACTAGGAGACAGTGGG + Intronic
1144404558 17:14940264-14940286 GTTTCTTACAAGGGGCCAGTAGG + Intergenic
1145803663 17:27710948-27710970 GCATTTTACCAGGGTACAGCAGG - Intergenic
1153638334 18:7132459-7132481 GAACTTTACTAGGGGCAAGAAGG + Intergenic
1156189040 18:34697408-34697430 GCATTTTAATAGGGGCCCTGTGG - Intronic
1159177999 18:64863803-64863825 GCTTTTTACTAGGGACTTGTAGG - Intergenic
1160325513 18:77944142-77944164 CCATTTCAGTAGGGGCCAATGGG - Intergenic
1163152089 19:15421710-15421732 GCATTTGGGTGGGGGCCAGTGGG - Exonic
1163205597 19:15800294-15800316 GCATTTTTCTAGGCACCACTGGG - Intergenic
927304839 2:21559100-21559122 TCATTTTACTAGGGATCAGTAGG - Intergenic
928724774 2:34159544-34159566 ACATTTTACTAAGGGCAAGGCGG - Intergenic
929904166 2:46031644-46031666 GCATTTTACTCTGGGTAAGTGGG - Intronic
930231015 2:48843811-48843833 GCATTGTACTGGGGACTAGTTGG + Intergenic
937253456 2:120538875-120538897 ACATTTTACAAGGCTCCAGTGGG - Intergenic
944284852 2:197937953-197937975 GCATTGTACTTGGGACCTGTTGG + Intronic
948556161 2:238813025-238813047 GCATTTTAGAAAGGGCAAGTGGG + Intergenic
1170307579 20:14956778-14956800 ACATTTAATTAGGGGGCAGTTGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1175743656 20:61437916-61437938 GTTTTCTACTAAGGGCCAGTAGG + Intronic
1176872124 21:14092442-14092464 CCATTTTACAAAGGGCCAATTGG + Intergenic
1183447125 22:37864837-37864859 CCATTTTAAAATGGGCCAGTAGG - Intronic
956632727 3:71331986-71332008 CCATTTTACAAAGAGCCAGTTGG - Intronic
957451289 3:80385825-80385847 GCATTTTACTAAGTGCAAATTGG - Intergenic
958998916 3:100939162-100939184 GAGTTTTACTAGGTCCCAGTAGG + Intronic
966670098 3:182516939-182516961 GAAGTTTAATAGGGTCCAGTGGG + Intergenic
970935733 4:21567866-21567888 ACATTTTTCTAGGTACCAGTGGG + Intronic
971747077 4:30596239-30596261 ACATTTTACTGGGGAACAGTGGG - Intergenic
971993245 4:33929102-33929124 GCACTGTACTAGGGGTCAGGGGG + Intergenic
981593490 4:146391873-146391895 GTAATTTTGTAGGGGCCAGTGGG - Intronic
992366056 5:76090953-76090975 GCATTTTAAAAGAGGCTAGTCGG - Intronic
993073841 5:83201382-83201404 GCATTTTACTAGGGGCCAGTGGG - Intronic
997501439 5:134377891-134377913 GCATTTTAAAAGATGCCAGTTGG + Intronic
998677921 5:144430422-144430444 GCATTTTAGTAGGAGCCAAAAGG + Intronic
999873106 5:155772816-155772838 GCATTTCAATAGGGGTTAGTAGG - Intergenic
1001406944 5:171483273-171483295 GCATTTTACTAGGGTCCTGGGGG + Intergenic
1004402290 6:15299892-15299914 CCATTTTCCTAAGGGACAGTGGG - Intronic
1007688664 6:43683226-43683248 TCATCTTACTAGAAGCCAGTGGG + Intronic
1011657441 6:89564566-89564588 TCAATTTACTATGGGCCAGCTGG + Intronic
1023487291 7:40700755-40700777 GTATTTTGTTAGAGGCCAGTAGG + Intronic
1034405227 7:150898423-150898445 GCAGTTTCCAAGGAGCCAGTTGG - Intergenic
1036262849 8:7254084-7254106 GGATTTTACTAGGTGCGTGTTGG - Intergenic
1036264154 8:7261707-7261729 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036265449 8:7269329-7269351 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036266751 8:7276951-7276973 GGATTTTACTAGGTGCGTGTTGG - Intergenic
1036268057 8:7284573-7284595 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036269361 8:7292195-7292217 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036270628 8:7299815-7299837 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036297231 8:7547229-7547251 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036298533 8:7554884-7554906 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036299838 8:7562534-7562556 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036301145 8:7570180-7570202 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036303739 8:7585474-7585496 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036314889 8:7712624-7712646 GGATTTTACTAGGTGCGTGTTGG - Intergenic
1036316194 8:7720246-7720268 GGATTTTACTAGGTGCGTGTTGG - Intergenic
1036317506 8:7727894-7727916 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036318814 8:7735542-7735564 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036320121 8:7743189-7743211 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036321430 8:7750837-7750859 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036322739 8:7758485-7758507 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036324040 8:7766134-7766156 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036325340 8:7773790-7773812 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036350721 8:8010529-8010551 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036352001 8:8018173-8018195 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036353301 8:8025819-8025841 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036354593 8:8033466-8033488 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036845999 8:12170957-12170979 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036867364 8:12413276-12413298 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1041057466 8:54001643-54001665 GCACTTTACTAGGGGCTTGCAGG + Intronic
1041721363 8:60979111-60979133 GCATTGGACTAGAAGCCAGTAGG + Intergenic
1043336683 8:79184699-79184721 ACTTTTTAATAGGGGCCATTCGG + Intergenic
1047594812 8:126367768-126367790 AGACTTTACTAGGGTCCAGTTGG + Intergenic
1051627862 9:19115196-19115218 AAATTTTACTAGGTGACAGTTGG - Intronic
1054888829 9:70229942-70229964 GGATTTTGCTAGGGGCAAGTGGG - Intergenic
1054888834 9:70229963-70229985 ACATTTTGCTAGGGGCAAGTGGG - Intergenic
1056030422 9:82547618-82547640 GCCTTCTACAAGGGGCCAGCAGG + Intergenic
1059460167 9:114424521-114424543 GGATTTTACAAGGGCCCAGCCGG - Exonic
1061907032 9:133704098-133704120 GCATGTCCCTAGGGGCCAGCAGG + Intronic
1062479278 9:136743986-136744008 GCTTTTGACTGGGGGCCAGCCGG - Intergenic
1190192605 X:48290201-48290223 GCATTTTACTATGGACTTGTTGG + Intergenic
1192200908 X:69066198-69066220 GCTTTTTAGTAGGGGACAGATGG + Intergenic
1193028914 X:76876880-76876902 GCCTTTTACTTGGGGGCATTTGG - Intergenic
1193869437 X:86778949-86778971 ACATTTTACTATGTGCCAGGGGG + Intronic
1200131051 X:153846341-153846363 GCATTTTACTACGGGCTAGCTGG - Intergenic