ID: 993078406

View in Genome Browser
Species Human (GRCh38)
Location 5:83265283-83265305
Sequence CAATTGCTATATATTTACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993078404_993078406 28 Left 993078404 5:83265232-83265254 CCTGAACTATAGACTTTTTAAAT 0: 1
1: 0
2: 2
3: 29
4: 438
Right 993078406 5:83265283-83265305 CAATTGCTATATATTTACTCTGG 0: 1
1: 0
2: 0
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993078406 Original CRISPR CAATTGCTATATATTTACTC TGG Intronic
901314583 1:8297574-8297596 CAATTGCTTTCTACTTACACGGG - Intergenic
901358499 1:8674128-8674150 CATTTGCTATAGATTTAATTTGG - Intronic
908041035 1:60113515-60113537 AAATAGCTTTTTATTTACTCAGG - Intergenic
909083013 1:71136736-71136758 AAAATACTACATATTTACTCAGG - Intergenic
909255986 1:73422767-73422789 TAATTGCTATATATTTAAGGTGG - Intergenic
910039899 1:82837670-82837692 CAAGAGCAATATATTTACTGGGG - Intergenic
915807934 1:158874376-158874398 CAATTCCTTGATATTGACTCAGG - Intergenic
917538218 1:175889757-175889779 CAGGTGTTCTATATTTACTCTGG - Intergenic
918229943 1:182519028-182519050 TAATTTCTATATTTTTTCTCTGG + Intronic
919242139 1:194927868-194927890 CAATTGCAATGTATTTAATCAGG + Intergenic
923053130 1:230402808-230402830 CAATGATTATATATTTAGTCTGG + Intronic
924266525 1:242287656-242287678 CAATGGCTATATATTTAGATAGG + Intronic
924410537 1:243800307-243800329 CATTTGATATATATTAACTGAGG - Intronic
1063291252 10:4751906-4751928 CAATAGATATATATTTATTTAGG - Intergenic
1064758678 10:18596451-18596473 CAATTTTTATAAATATACTCAGG + Intronic
1066718306 10:38310901-38310923 CAATGGCTATATATTTAGATAGG - Intergenic
1070049830 10:72877517-72877539 CAATAACTAAATATTTACTCTGG + Intronic
1071723834 10:88175942-88175964 GAATTGCTATATATTTTTGCTGG + Intergenic
1073904335 10:108260250-108260272 CAATTCCTATATATTTAAAGTGG + Intergenic
1074333030 10:112539054-112539076 TAATGGATATTTATTTACTCTGG - Intronic
1074416516 10:113272029-113272051 CAATTTCTATATCTTGACTCTGG + Intergenic
1075234880 10:120718612-120718634 CACTTGCTATCTATTGCCTCTGG + Intergenic
1078923766 11:15855940-15855962 CAATTTCTATAGTTTTACTTTGG + Intergenic
1079853709 11:25572616-25572638 CACTAGCTATATGTTTATTCTGG - Intergenic
1080025021 11:27604403-27604425 CATTTACTAAATATTTTCTCAGG - Intergenic
1082649827 11:55776109-55776131 CTTTTGCTATAGACTTACTCAGG + Intergenic
1085723622 11:78934612-78934634 CAATTGTTTTAAATTCACTCTGG - Intronic
1085903067 11:80725302-80725324 CAGTTCCTAGGTATTTACTCAGG - Intergenic
1086407900 11:86514805-86514827 CATTTGTTATGTATTTACTATGG - Intronic
1088076825 11:105860096-105860118 TAATTACTATATAATTATTCTGG - Intronic
1089340222 11:117752306-117752328 CAATTTATGTTTATTTACTCAGG + Intronic
1090115179 11:123963828-123963850 CTACTCCTATATATTTACCCAGG + Intergenic
1092641114 12:10510845-10510867 TAATTGCCATATATTCACTTTGG - Intronic
1093108182 12:15115162-15115184 CTATTATTATATATTTACTTAGG - Intronic
1093784124 12:23173219-23173241 CATCTGATAGATATTTACTCTGG + Intergenic
1097091848 12:56511934-56511956 CAATTGCCATATCTTTAAGCTGG - Intergenic
1097677456 12:62618420-62618442 AGATAGCTATATATTTACTTAGG - Intergenic
1098085892 12:66843061-66843083 CTATTACTAGATATTTTCTCAGG - Intergenic
1098720564 12:73892297-73892319 CATTTGCTATTTATTTATTCTGG + Intergenic
1099101425 12:78446163-78446185 CAAATGCTATATATGTATTGTGG - Intergenic
1099566611 12:84256650-84256672 AAATTTGTATATATTTACTGTGG + Intergenic
1099993008 12:89746497-89746519 CTACTTCTAGATATTTACTCAGG - Intergenic
1104136646 12:125946390-125946412 CAAATTCTCTATATTTAATCTGG - Intergenic
1108476711 13:50826439-50826461 CACTTTATATATATTTAATCAGG - Intronic
1109052059 13:57495731-57495753 AAATTGCTATATCCTTACTGGGG + Intergenic
1111250213 13:85591722-85591744 CTATTTCTATATATTTTCTGAGG + Intergenic
1112642269 13:101289223-101289245 AAATTACTAAATATTGACTCTGG - Intronic
1113112374 13:106837359-106837381 CAATTGCTATACACGTACACTGG - Intergenic
1114897636 14:27011243-27011265 ACATTGCTTTATATTTATTCTGG - Intergenic
1117144534 14:52823623-52823645 CAATTCTCATATATTTACCCAGG + Intergenic
1117863056 14:60113290-60113312 TAATTGCTATACATTTGCTTTGG + Intronic
1119254037 14:73182946-73182968 CAATTATTTAATATTTACTCTGG + Intronic
1120136839 14:80879318-80879340 CAATTACTATATAATTATTGTGG - Intronic
1120379737 14:83761224-83761246 CAATTACAATATATTTTATCTGG + Intergenic
1121896304 14:97651214-97651236 CAATTGCCTTATTTTTACTTTGG - Intergenic
1124927661 15:34087189-34087211 AAATTGATAAATGTTTACTCAGG + Intronic
1125791273 15:42367735-42367757 CAAATGTAATATATTTTCTCTGG + Intronic
1126714102 15:51495530-51495552 CATTTGTTATATATTTAAGCAGG + Intronic
1127744238 15:61948875-61948897 CAAATGTTATTTATTCACTCAGG + Intronic
1128910905 15:71513672-71513694 AAATTGCTGGGTATTTACTCAGG + Intronic
1129692205 15:77720243-77720265 TAATTGCTGTTTATTTCCTCTGG - Intronic
1131555692 15:93396896-93396918 CAATTTCTAAATATTTATTGTGG - Intergenic
1133147675 16:3802082-3802104 CAAACTCTTTATATTTACTCTGG + Intronic
1137913777 16:52405970-52405992 CAATTCCTATTTATTTAGACAGG + Intergenic
1138986805 16:62338854-62338876 CAATTGTTATATATTTTATGTGG + Intergenic
1139836793 16:69845458-69845480 CAAAAGCTAAATATTTAGTCTGG - Intronic
1148262791 17:46197981-46198003 CAATTATTATATATTAACTCAGG + Intronic
1150570307 17:66380311-66380333 CAATTTCTGTAGTTTTACTCAGG + Intronic
1154067304 18:11119654-11119676 CAAGTGCTGTATTTATACTCTGG - Intronic
1155644051 18:28055736-28055758 TAACTGCTATATATATACTTCGG + Intronic
1156120688 18:33839477-33839499 GCTTTGCTATTTATTTACTCTGG + Intergenic
1156334916 18:36161605-36161627 CAATTGCTATATCATTCCACAGG - Intronic
1156573626 18:38286649-38286671 TGATTGCTATTTATTTTCTCTGG + Intergenic
1157018776 18:43753644-43753666 CAATTGCTATCTAGTACCTCAGG + Intergenic
1157132638 18:45021653-45021675 GAATTTTTATATATTTGCTCTGG - Intronic
1158852373 18:61508189-61508211 CATTAGATATATATTTACTATGG - Intronic
1159251725 18:65887460-65887482 AAATTGCTATATAGTTACACAGG - Exonic
1159456564 18:68666822-68666844 CAATTACTATATTTTAAATCAGG - Intergenic
1165641212 19:37388745-37388767 GAATTCCTATATCTTTACTAAGG - Exonic
926539354 2:14155557-14155579 CAATTGCTAAATTTTTAGTTAGG - Intergenic
926700199 2:15798321-15798343 CAATTTGTTTATATTTACTTGGG - Intergenic
926807405 2:16723849-16723871 CAATTGCTAAATATTTTCTGTGG + Intergenic
926893163 2:17656160-17656182 CAATTGTTATAAATTTATTTGGG - Exonic
928287625 2:30007251-30007273 CCTTTGCTATATGTTGACTCAGG - Intergenic
931032839 2:58201514-58201536 CAATTTGTATGTATTTACTTGGG - Intronic
931603179 2:64024517-64024539 CAACTGCTATGTATTTACCCTGG + Intergenic
931972051 2:67599621-67599643 CAATTGCTAGAAATTTTGTCTGG + Intergenic
932919615 2:75895944-75895966 AAATTGTTATATATTAGCTCAGG + Intergenic
933440975 2:82313574-82313596 AAATTGGTATTTATTTATTCTGG - Intergenic
935479469 2:103567133-103567155 CAATTCCTTTATATTTATCCAGG - Intergenic
935550343 2:104446395-104446417 CAATTGCTATTTTTTAACTGTGG - Intergenic
936864027 2:117056373-117056395 CAATTGATATATGTTTTCCCAGG + Intergenic
939000228 2:136726334-136726356 TAATTGCTTTATATTTTCTGTGG + Intergenic
939569707 2:143826333-143826355 CAGATTCTATATATTTACCCAGG + Intergenic
940687787 2:156875606-156875628 GAATTCCTATATTTTTCCTCTGG - Intergenic
942593509 2:177570578-177570600 TATTTGCTATTTATCTACTCTGG + Intergenic
943991407 2:194697893-194697915 CAATTGCTCTAAACTTAATCAGG + Intergenic
946634985 2:221714815-221714837 CAATTGCCAAATATCTTCTCTGG + Intergenic
946828345 2:223702136-223702158 CAATTGGTATAAATTGTCTCAGG + Intergenic
1168926261 20:1582199-1582221 TGATGGCTATATATTTCCTCAGG + Intronic
1171244303 20:23598130-23598152 CTATTGCTGGAGATTTACTCAGG + Intergenic
1175159388 20:56996541-56996563 CTATTGCTATACATTTGCTATGG - Intergenic
1175986493 20:62766438-62766460 CAATAGCTATTTTTTAACTCTGG + Intergenic
1177082561 21:16658804-16658826 CTATTGCTATATTTTTATTTTGG - Intergenic
1178799911 21:35784118-35784140 TAAATGCTTTATATTTACTCAGG - Intronic
949336059 3:2977300-2977322 CAAGTGATAAATATTTACTTTGG - Intronic
950298958 3:11857357-11857379 CAAATCCTAGATATTTACCCTGG - Intergenic
951159198 3:19395989-19396011 CATTTTCTATAAATTTACTGTGG - Intronic
951363544 3:21752361-21752383 CAATTGATATATTTTTAATCTGG + Intronic
952573823 3:34749755-34749777 TAATTGCTTTATATTGTCTCTGG - Intergenic
954910295 3:54100502-54100524 AAATTCCTAGGTATTTACTCAGG - Intergenic
956831485 3:73053532-73053554 CAATTGCTATAGATTAATTTTGG + Intronic
958813158 3:98886247-98886269 CAAATGATATATATTTTTTCTGG + Intronic
959111681 3:102130311-102130333 CAACTGCTAAAAATTTCCTCAGG - Intronic
964900294 3:161650962-161650984 CAATTGCTATAGAAATAGTCAGG - Intergenic
966057108 3:175707629-175707651 CAATTTCTTTATATGTACACTGG + Intronic
966064734 3:175805627-175805649 CACTTGCTATTAATTTGCTCAGG - Exonic
966120334 3:176513076-176513098 AAATTTCTATATATTTATTGGGG + Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
967393295 3:188978700-188978722 CAATTGCATTCAATTTACTCTGG - Intronic
970703097 4:18766329-18766351 AAATTGGTATATATTTCCTTTGG - Intergenic
971001273 4:22325495-22325517 CTATTGCTAAATATTTACTTAGG - Intergenic
972007320 4:34127250-34127272 CAATTAATGTATTTTTACTCAGG - Intergenic
972026036 4:34379002-34379024 GAATTGCTATAGAACTACTCTGG + Intergenic
974265062 4:59576556-59576578 CAATTTCTATATATTTAGAAAGG - Intergenic
974317478 4:60300803-60300825 CAATGACTATATATTTTCTTTGG - Intergenic
975407497 4:74007685-74007707 CAATAGCTATTTATTGTCTCAGG - Intergenic
976581076 4:86738213-86738235 CTACTGCTAGATATTTACTCAGG - Intronic
977825766 4:101529871-101529893 AACTTGCTGTATAATTACTCTGG + Intronic
977916610 4:102601410-102601432 CATTTGATATACATTTAATCTGG - Intronic
978051117 4:104201621-104201643 CAATTGCTATGTTTTTACAGTGG + Intergenic
978763788 4:112383402-112383424 CAATGTCTATATATTTATTTTGG - Intronic
981282767 4:142978292-142978314 CAAAAGCTATGTATTTAATCAGG + Intergenic
982081781 4:151797221-151797243 CAAATGCTATATATGTGCCCAGG - Intergenic
982322793 4:154097132-154097154 ACATAGCTATATATTTACTCTGG - Intergenic
983056983 4:163109421-163109443 CAATTGTTATTTATTCACTTTGG + Intergenic
985668926 5:1196515-1196537 CTATTTCTAGATATTTTCTCAGG + Intergenic
988047616 5:25977736-25977758 CAATGGCTATATAATTATTTGGG + Intergenic
988703364 5:33698425-33698447 CAATTTTTATATTTTTATTCTGG - Intronic
989244230 5:39235606-39235628 CAGCTCCTATATATCTACTCAGG - Intronic
989783027 5:45292368-45292390 CAACTGCTATATATTGACAGTGG + Intronic
991601661 5:68356998-68357020 CAGTTGCAGGATATTTACTCCGG + Intergenic
992988819 5:82262075-82262097 AAATTGCTATATCCTTACTGGGG - Intronic
993078406 5:83265283-83265305 CAATTGCTATATATTTACTCTGG + Intronic
993148399 5:84127025-84127047 AATTTGCTTTATATTTTCTCTGG - Intronic
994003533 5:94810166-94810188 CAATTTCTATATATTTTCTAAGG + Intronic
996393295 5:122986974-122986996 CAATTCCTATATCTCTGCTCTGG - Intronic
998180846 5:139939834-139939856 CCATTGCTATATATTTTTTTTGG - Intronic
998304342 5:141058725-141058747 CCATTGCTAGATATTTCCTGTGG + Intergenic
998498706 5:142613670-142613692 CAATTGCTGTATGTTTTCCCAGG - Intronic
998630766 5:143896106-143896128 TAATTTTTATATAATTACTCTGG - Intergenic
1004863218 6:19827562-19827584 AATTTGCTAGATATTTTCTCAGG - Intergenic
1004986021 6:21083659-21083681 CAATTGCTATACATATTGTCGGG - Intronic
1008376290 6:50795617-50795639 CATTTGCTATTTACTTACACAGG - Intergenic
1009386409 6:63087547-63087569 GGATTGCTAGAAATTTACTCTGG + Intergenic
1010108368 6:72194468-72194490 CATTTTCTATGTATTTACTGAGG + Intronic
1011580351 6:88856598-88856620 CAAGTGCTAAATAATTTCTCTGG - Intronic
1012578948 6:100840305-100840327 CTTATGCTAAATATTTACTCAGG - Intronic
1013437617 6:110127451-110127473 TAATTGATATATACTTACTTAGG + Exonic
1014441176 6:121475827-121475849 CAGTTGGTATTTATTTACTGTGG - Intergenic
1014826003 6:126049113-126049135 CATTTGTTCTATATTTTCTCTGG + Intergenic
1015669235 6:135668932-135668954 CAATTCCTATACATTTAAGCTGG + Intergenic
1016315271 6:142778589-142778611 CATTTACTATATATTTACCATGG + Intronic
1016591792 6:145754157-145754179 GAATTGGTATAAATGTACTCTGG + Intergenic
1020722704 7:11768380-11768402 CAATTGTTATATATATCCTATGG - Intronic
1020879582 7:13742593-13742615 CATTTCCAATATATTCACTCTGG + Intergenic
1021758177 7:23876219-23876241 CTCTTGCTATACATTTTCTCTGG - Intergenic
1021838240 7:24701909-24701931 CATTTGGTATACATCTACTCTGG - Intronic
1023325361 7:39049752-39049774 TAATTTCTATATCTTTACTGAGG + Intronic
1024860220 7:53830829-53830851 CTATTGTAATATATTTTCTCTGG - Intergenic
1026602827 7:71790791-71790813 CAATTGCTAGACATCCACTCGGG + Intronic
1027514032 7:79119115-79119137 TAATTGACATAAATTTACTCAGG + Intronic
1029881855 7:103821701-103821723 CACTTTCAATATATTTACTTAGG + Intronic
1030397482 7:109005486-109005508 CAATTTTTATAAATTTACTGTGG - Intergenic
1031240472 7:119231622-119231644 CAACTGTAATATATTTACTGAGG - Intergenic
1031355588 7:120782880-120782902 CAATTTATATATATATAGTCAGG - Intergenic
1031847514 7:126824234-126824256 CCATTGCTATAAATTCACCCAGG - Intronic
1032817485 7:135491822-135491844 TAACTCCTATAGATTTACTCTGG - Intronic
1033201962 7:139380813-139380835 CAATTTCTTTATCTTTCCTCAGG - Intronic
1033993338 7:147314810-147314832 CATTGACTATATATTTACTAGGG - Intronic
1036598288 8:10234605-10234627 TAATTTTAATATATTTACTCTGG - Intronic
1038069195 8:23994554-23994576 AGATCGCTATATATTTACACAGG - Intergenic
1040875325 8:52145577-52145599 CAAATGCTATTGATTTACACTGG - Intronic
1041864308 8:62551883-62551905 CACTTGCTATACTTTTACTCAGG + Intronic
1042005847 8:64178737-64178759 CAATTACTAAATATTTATTGTGG - Intergenic
1042378806 8:68088189-68088211 CTATTGCTATATACTTCCTTCGG + Intronic
1042579132 8:70257321-70257343 TAATTGCCATACATTTATTCAGG + Intronic
1042951840 8:74208239-74208261 CATTTGGGTTATATTTACTCAGG - Intergenic
1045767904 8:105697594-105697616 CTTTAGCTTTATATTTACTCTGG + Intronic
1045820238 8:106328813-106328835 CAGTTGCTAACTATTGACTCTGG - Intronic
1046169944 8:110492135-110492157 TAATTGTTTTTTATTTACTCAGG + Intergenic
1046420604 8:113978836-113978858 CAATTGATTTATATTTAAACAGG + Intergenic
1048753260 8:137703613-137703635 CACTTACTATATTTTTACTAAGG + Intergenic
1056084590 9:83133414-83133436 CCCTTGTTATATATTTACTAAGG - Intergenic
1056318230 9:85412108-85412130 CCATCGCTATGTATTTACCCAGG + Intergenic
1058434826 9:104952742-104952764 CAATAGCTATAAGTTAACTCAGG - Intergenic
1058629207 9:106969377-106969399 CAAATTCTATATTTTAACTCTGG - Intronic
1058772251 9:108247398-108247420 CAAATGATATATGTTTACACTGG - Intergenic
1186718734 X:12280216-12280238 CAAGTGCTACATATTTAGTAAGG + Intronic
1189102053 X:38200842-38200864 CAAATGCTGTATGTTTACTGTGG - Intronic
1189182475 X:39017207-39017229 GATTTGCTTTATATGTACTCTGG + Intergenic
1190776628 X:53557601-53557623 CAATTTCTCTATACATACTCAGG + Intronic
1191753596 X:64570241-64570263 CAATTGCTAAATACTGACTGAGG - Intergenic
1194490614 X:94543737-94543759 AAATTGCTGTATATTTTGTCAGG + Intergenic
1195769980 X:108340392-108340414 CAATTTCTAGATATATACACTGG - Intronic
1197192908 X:123668614-123668636 GAACTGCTATATATTTTCTTGGG - Intronic
1197665124 X:129215164-129215186 CAATCCATACATATTTACTCAGG + Intergenic
1200001293 X:153061700-153061722 CCATTCCTAGGTATTTACTCGGG - Intergenic
1201867273 Y:18668911-18668933 CAATTGCTATACATTTGTACAGG - Intergenic