ID: 993090449

View in Genome Browser
Species Human (GRCh38)
Location 5:83419872-83419894
Sequence TAATACTGGATTGAACCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993090449_993090451 -9 Left 993090449 5:83419872-83419894 CCACAAGGTTCAATCCAGTATTA No data
Right 993090451 5:83419886-83419908 CCAGTATTATAAGAAGTAAGAGG No data
993090449_993090452 13 Left 993090449 5:83419872-83419894 CCACAAGGTTCAATCCAGTATTA No data
Right 993090452 5:83419908-83419930 GTAGTGTCTTCTAGACGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993090449 Original CRISPR TAATACTGGATTGAACCTTG TGG (reversed) Intergenic
No off target data available for this crispr