ID: 993106728

View in Genome Browser
Species Human (GRCh38)
Location 5:83608472-83608494
Sequence TGTGGTCCATCTTTATAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993106722_993106728 13 Left 993106722 5:83608436-83608458 CCATCAGCGTCATACCAGTGACA No data
Right 993106728 5:83608472-83608494 TGTGGTCCATCTTTATAGCCAGG No data
993106726_993106728 -1 Left 993106726 5:83608450-83608472 CCAGTGACAGGCTGGGAATGTCT No data
Right 993106728 5:83608472-83608494 TGTGGTCCATCTTTATAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993106728 Original CRISPR TGTGGTCCATCTTTATAGCC AGG Intergenic
No off target data available for this crispr