ID: 993117029

View in Genome Browser
Species Human (GRCh38)
Location 5:83731959-83731981
Sequence ATATCTTGTAAGTTTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993117026_993117029 23 Left 993117026 5:83731913-83731935 CCTAAATGTCAGATAGAGAATGC No data
Right 993117029 5:83731959-83731981 ATATCTTGTAAGTTTAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993117029 Original CRISPR ATATCTTGTAAGTTTAAAGC AGG Intergenic
No off target data available for this crispr