ID: 993126691

View in Genome Browser
Species Human (GRCh38)
Location 5:83844324-83844346
Sequence TGAGGCAATGAGAGTGAGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993126691_993126702 26 Left 993126691 5:83844324-83844346 CCGATCTCACTCTCATTGCCTCA No data
Right 993126702 5:83844373-83844395 CCTCACTCATGGCAGTACAGGGG No data
993126691_993126695 3 Left 993126691 5:83844324-83844346 CCGATCTCACTCTCATTGCCTCA No data
Right 993126695 5:83844350-83844372 TTCCACACTCAGCACATTACCGG No data
993126691_993126697 15 Left 993126691 5:83844324-83844346 CCGATCTCACTCTCATTGCCTCA No data
Right 993126697 5:83844362-83844384 CACATTACCGGCCTCACTCATGG No data
993126691_993126700 25 Left 993126691 5:83844324-83844346 CCGATCTCACTCTCATTGCCTCA No data
Right 993126700 5:83844372-83844394 GCCTCACTCATGGCAGTACAGGG No data
993126691_993126699 24 Left 993126691 5:83844324-83844346 CCGATCTCACTCTCATTGCCTCA No data
Right 993126699 5:83844371-83844393 GGCCTCACTCATGGCAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993126691 Original CRISPR TGAGGCAATGAGAGTGAGAT CGG (reversed) Intergenic
No off target data available for this crispr