ID: 993128577

View in Genome Browser
Species Human (GRCh38)
Location 5:83866941-83866963
Sequence GGGTGGTTTAATACAATATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993128577_993128579 -6 Left 993128577 5:83866941-83866963 CCACATATTGTATTAAACCACCC No data
Right 993128579 5:83866958-83866980 CCACCCACATTGTTGAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993128577 Original CRISPR GGGTGGTTTAATACAATATG TGG (reversed) Intergenic
No off target data available for this crispr