ID: 993130027

View in Genome Browser
Species Human (GRCh38)
Location 5:83884900-83884922
Sequence CTGTAGTAGAATGTAAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993130027_993130028 -8 Left 993130027 5:83884900-83884922 CCTGAGTTTACATTCTACTACAG No data
Right 993130028 5:83884915-83884937 TACTACAGTAAAATAATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993130027 Original CRISPR CTGTAGTAGAATGTAAACTC AGG (reversed) Intergenic
No off target data available for this crispr