ID: 993132401

View in Genome Browser
Species Human (GRCh38)
Location 5:83915184-83915206
Sequence CTTCCCACCACAGTTTCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993132401_993132404 -5 Left 993132401 5:83915184-83915206 CCTTAGGAAACTGTGGTGGGAAG No data
Right 993132404 5:83915202-83915224 GGAAGATTGGGCTTGAGCCCAGG No data
993132401_993132406 1 Left 993132401 5:83915184-83915206 CCTTAGGAAACTGTGGTGGGAAG No data
Right 993132406 5:83915208-83915230 TTGGGCTTGAGCCCAGGTGGTGG No data
993132401_993132407 4 Left 993132401 5:83915184-83915206 CCTTAGGAAACTGTGGTGGGAAG No data
Right 993132407 5:83915211-83915233 GGCTTGAGCCCAGGTGGTGGAGG No data
993132401_993132405 -2 Left 993132401 5:83915184-83915206 CCTTAGGAAACTGTGGTGGGAAG No data
Right 993132405 5:83915205-83915227 AGATTGGGCTTGAGCCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993132401 Original CRISPR CTTCCCACCACAGTTTCCTA AGG (reversed) Intergenic
No off target data available for this crispr