ID: 993132405

View in Genome Browser
Species Human (GRCh38)
Location 5:83915205-83915227
Sequence AGATTGGGCTTGAGCCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993132396_993132405 5 Left 993132396 5:83915177-83915199 CCCAGCTCCTTAGGAAACTGTGG No data
Right 993132405 5:83915205-83915227 AGATTGGGCTTGAGCCCAGGTGG No data
993132394_993132405 13 Left 993132394 5:83915169-83915191 CCTGTGGCCCCAGCTCCTTAGGA No data
Right 993132405 5:83915205-83915227 AGATTGGGCTTGAGCCCAGGTGG No data
993132398_993132405 4 Left 993132398 5:83915178-83915200 CCAGCTCCTTAGGAAACTGTGGT No data
Right 993132405 5:83915205-83915227 AGATTGGGCTTGAGCCCAGGTGG No data
993132401_993132405 -2 Left 993132401 5:83915184-83915206 CCTTAGGAAACTGTGGTGGGAAG No data
Right 993132405 5:83915205-83915227 AGATTGGGCTTGAGCCCAGGTGG No data
993132395_993132405 6 Left 993132395 5:83915176-83915198 CCCCAGCTCCTTAGGAAACTGTG No data
Right 993132405 5:83915205-83915227 AGATTGGGCTTGAGCCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993132405 Original CRISPR AGATTGGGCTTGAGCCCAGG TGG Intergenic
No off target data available for this crispr