ID: 993134199

View in Genome Browser
Species Human (GRCh38)
Location 5:83936663-83936685
Sequence CCAGGTCATCATACAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993134194_993134199 26 Left 993134194 5:83936614-83936636 CCTCTATACTGTGAGTTCCAAAA No data
Right 993134199 5:83936663-83936685 CCAGGTCATCATACAGTGGCTGG No data
993134195_993134199 9 Left 993134195 5:83936631-83936653 CCAAAAATCACTGTATTTTCATC No data
Right 993134199 5:83936663-83936685 CCAGGTCATCATACAGTGGCTGG No data
993134193_993134199 27 Left 993134193 5:83936613-83936635 CCCTCTATACTGTGAGTTCCAAA No data
Right 993134199 5:83936663-83936685 CCAGGTCATCATACAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993134199 Original CRISPR CCAGGTCATCATACAGTGGC TGG Intergenic
No off target data available for this crispr