ID: 993134868

View in Genome Browser
Species Human (GRCh38)
Location 5:83947292-83947314
Sequence CTGCTGTTCTTAAGGGATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993134863_993134868 11 Left 993134863 5:83947258-83947280 CCACTGGCCTTACTGACTGTATC 0: 1
1: 0
2: 0
3: 10
4: 145
Right 993134868 5:83947292-83947314 CTGCTGTTCTTAAGGGATAGAGG 0: 1
1: 0
2: 1
3: 12
4: 290
993134864_993134868 4 Left 993134864 5:83947265-83947287 CCTTACTGACTGTATCTGTACAC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 993134868 5:83947292-83947314 CTGCTGTTCTTAAGGGATAGAGG 0: 1
1: 0
2: 1
3: 12
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993134868 Original CRISPR CTGCTGTTCTTAAGGGATAG AGG Intronic
903996311 1:27307315-27307337 CTGCTGCTCTGAGGGGAGAGGGG + Exonic
907685961 1:56611725-56611747 CTGATGTTCATCAGGGATATTGG - Intronic
907728218 1:57040264-57040286 ATGCTGTTGTCATGGGATAGAGG + Intronic
909297256 1:73966649-73966671 CTGATGTTCGTCAGGGATATTGG + Intergenic
909396666 1:75178102-75178124 CTGATGTTCATCAGGGATATTGG + Intergenic
910929924 1:92433187-92433209 CTGATGTTCATCAGGGATATTGG + Intergenic
911425359 1:97704100-97704122 CTGATGTTTTAAAGGGATAGAGG - Intronic
911495095 1:98621652-98621674 TTGATGTTCTTCAGGGATACTGG + Intergenic
911504346 1:98729973-98729995 CTGATGTTCATCAGGGATACTGG - Intronic
911508938 1:98787774-98787796 CTGATGTTCATCAGGGATATTGG - Intergenic
912093773 1:106114388-106114410 CTGATGTTCATCAGGGATATTGG - Intergenic
912557951 1:110529836-110529858 CTGCTGTTCTCGAGGTAAAGAGG + Intergenic
912939574 1:114033093-114033115 CTTCTGTTCTTCATGGATGGGGG - Intergenic
913108314 1:115635896-115635918 TTGCTGTTCATCAGGGATATTGG + Intergenic
913563479 1:120047125-120047147 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
914284073 1:146206489-146206511 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914545104 1:148657228-148657250 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
915846572 1:159272260-159272282 TTGATGTTCTTCAGGGATATTGG - Intergenic
916869459 1:168896940-168896962 CTGTGGTTCTTAAGGAAAAGTGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917572632 1:176284686-176284708 CTGATGTTCATCAGGGATATTGG + Intergenic
918973072 1:191445201-191445223 CTGATGTTCATCAGGGATATTGG + Intergenic
919142057 1:193584815-193584837 CTGCTCTTCCTAAGGGATTCAGG + Intergenic
920508296 1:206532509-206532531 CTGCTGGTCCTCAGGGAGAGAGG + Intronic
921488245 1:215741449-215741471 CTCCTGTTCTTAAGGCACTGGGG - Exonic
921915689 1:220607981-220608003 TTGATGTTCTTCAGGGATATTGG + Intronic
922692245 1:227703330-227703352 CTGATGTTCATCAGGGATATTGG - Intergenic
922820749 1:228483736-228483758 CTGCTGGTGGTAAGGGAGAGAGG + Intergenic
923060906 1:230473071-230473093 TTGCTGTTCATCAGGGATATTGG + Intergenic
923902618 1:238344418-238344440 TTGATGTTCATAAGGGATATTGG + Intergenic
924179629 1:241427393-241427415 TTGATGTTCTTCAGGGATATTGG + Intergenic
1067579210 10:47430258-47430280 TTGATGTTCTTCAGGGATATTGG + Intergenic
1068184392 10:53565725-53565747 CCTCTGTTCTTGAGGGATATTGG - Intergenic
1068411390 10:56660276-56660298 CTGCTTTTCTTAAGTGGAAGGGG + Intergenic
1068490675 10:57719801-57719823 TTGCTGTTCATCAGGGATATTGG - Intergenic
1068516675 10:58033770-58033792 TTGATGTTCTTCAGGGATATTGG + Intergenic
1071134208 10:82434871-82434893 CTGATGTTCATCAGGGATATTGG + Intronic
1072100740 10:92226918-92226940 CTGCAGTTCTGAAGGGGGAGGGG - Intronic
1072849662 10:98875037-98875059 CTGATGTTCATTAGGGATATTGG + Intronic
1074828907 10:117234970-117234992 CAACTGTTATTAAGGGATGGGGG - Intergenic
1078034477 11:7788757-7788779 CTGATGTTCATCAGGGATATTGG - Intergenic
1079578150 11:22028653-22028675 CTGATGTTCATCAGGGATATTGG - Intergenic
1079757376 11:24281495-24281517 CTGATGTTCATCAGGGATATTGG + Intergenic
1080489154 11:32744335-32744357 CTGATGTTCATCAGGGATATTGG + Intronic
1080691142 11:34559058-34559080 ATGGTTTTCTTAAGGGACAGAGG + Intergenic
1081667214 11:44923569-44923591 CCTCTGTGCTTAAGGGAAAGGGG - Intronic
1081940269 11:46935810-46935832 TTGCTCTTCTTGAGGGAGAGGGG - Intergenic
1086289955 11:85297277-85297299 CTTTTGTTCTAAAGTGATAGTGG + Intronic
1087753801 11:102033845-102033867 TTGATGTTCTTCAGGGATATTGG + Intergenic
1090682968 11:129081327-129081349 CATCTGTTCTTCAGGGATATTGG - Intronic
1090718205 11:129449269-129449291 CTGCTGCTCTTGAAGGAAAGAGG + Intronic
1091146049 11:133281306-133281328 GTGCTGTTCTTAAGGTAATGTGG + Intronic
1092703588 12:11260035-11260057 CTGATGTTCATCAGGGATATTGG - Intergenic
1096894693 12:54809370-54809392 CTGATGTTCATCAGGGATATTGG + Intergenic
1101362147 12:104037859-104037881 CTGATGTTCATAAGGGATATTGG - Intronic
1101596193 12:106167153-106167175 CTGGTGTTCATCAGGGATATTGG - Intergenic
1105789414 13:23783170-23783192 CTGATGTTCATCAGGGATATTGG - Intronic
1106026012 13:25955839-25955861 CTGATGTTCATCAGGGATATTGG - Intronic
1106068235 13:26379906-26379928 CTTCTGTCATTAAGGGAGAGGGG + Intronic
1107310661 13:39073829-39073851 CTCCTGCTCTTCAGAGATAGTGG - Intergenic
1107527476 13:41247630-41247652 CTGCAGTTCTGGAGGGATTGTGG - Intronic
1108567017 13:51710001-51710023 CTGATGTTCATCAGGGATATTGG - Intronic
1110656121 13:78002037-78002059 TCGATGTTCTTAAGGGATATTGG - Intergenic
1110737120 13:78950247-78950269 CTGATGTTCATCAGGGATATTGG + Intergenic
1110968522 13:81731719-81731741 TTGATGTTCATAAGGGATATTGG + Intergenic
1111056407 13:82956348-82956370 CTGATGTTCATCAGGGATATTGG - Intergenic
1111575180 13:90144265-90144287 CTGATGTTCATCAGGGATATTGG - Intergenic
1111712417 13:91833463-91833485 TTGATGTTCATCAGGGATAGTGG - Intronic
1113373097 13:109740429-109740451 CTGCTGTTATAAAGGAAAAGAGG + Intergenic
1113528047 13:110997262-110997284 CTGATGTTCATCAGGGATATTGG - Intergenic
1114914825 14:27250083-27250105 CTGATGTTCATCAGGGATACTGG - Intergenic
1115717414 14:36121611-36121633 CTGATGTTCATCAGGGATATTGG + Intergenic
1116757917 14:48970873-48970895 CTCCTGTCCTTAAGTGATAAAGG - Intergenic
1117655801 14:57955006-57955028 TTGCTGTTCATCAGGGATATTGG - Intronic
1118515745 14:66526902-66526924 CTGATGTTCATCAGGGATATTGG + Intronic
1118926620 14:70196414-70196436 CTGATGTTCATCAGGGATATTGG + Intergenic
1119079471 14:71678568-71678590 CTGATGTTCATCAGGGATATTGG + Intronic
1119161380 14:72455315-72455337 CTGATGTTCTTAATGGACATTGG + Intronic
1120478599 14:85020802-85020824 CTGATGTTCATCAGGGATATTGG + Intergenic
1120557059 14:85940564-85940586 CTTCTGTTCTTAAAGGATATTGG + Intergenic
1120879336 14:89402746-89402768 CTGCTGTTCTTAGGGCATTGCGG - Intronic
1124142692 15:27091067-27091089 TTCCTGTTCTTAAGGGAGAAAGG + Intronic
1124987172 15:34631734-34631756 CTGATGTTCATCAGGGATATTGG - Intergenic
1125204257 15:37134349-37134371 CTGATGTTCTTAGGGAATGGGGG + Intergenic
1126278120 15:46908935-46908957 CTGATGTTCATCAGGGATATTGG + Intergenic
1126554421 15:49969836-49969858 CTGATGTTCATCAGGGATATTGG - Intronic
1127368902 15:58317523-58317545 CTGATGTTCATAAAGGATATTGG + Intronic
1128460254 15:67861596-67861618 CTGCTTTTCACAGGGGATAGGGG - Intergenic
1129447141 15:75626208-75626230 CTGCTTTTGTTAAGGGCAAGTGG - Intronic
1129464149 15:75714493-75714515 CTGCTGTTCTGTAGGGATTTTGG + Intergenic
1131591541 15:93754607-93754629 TTGCTGTTCATCAGGGATATTGG + Intergenic
1132188827 15:99830379-99830401 TTGATGTTCTTCAGGGATATTGG + Intergenic
1133118563 16:3592346-3592368 CTGCTGTTGTTCAGGTCTAGTGG + Intronic
1135022611 16:18975488-18975510 CTGATTTGCTTAAGAGATAGTGG - Intergenic
1135158795 16:20075244-20075266 TTGCTGGTCTTGAGGGACAGGGG - Intergenic
1139155271 16:64434041-64434063 TTGATGTTCTTCAGGGATATTGG - Intergenic
1142911919 17:3101236-3101258 TTGATGTTCTTCAGGGATATTGG - Intergenic
1143716716 17:8777053-8777075 TTGTTGTTTTTAAGGGATAATGG + Intergenic
1144137706 17:12314361-12314383 CTGCTGTGCTGAAGGGACTGAGG + Intergenic
1149806485 17:59621839-59621861 GTGCTGTTCTTAAGTGTGAGGGG + Intronic
1155294622 18:24373822-24373844 ATGCAGTTCTTAAGGGAGTGGGG - Intronic
1155562311 18:27091873-27091895 TTGATGTTCTTCAGGGATATTGG + Intronic
1155701476 18:28749486-28749508 CTGATGTTCATCAGGGATATTGG - Intergenic
1157000193 18:43513964-43513986 CTGTAGTTTTTAGGGGATAGAGG + Intergenic
1157088596 18:44608279-44608301 CTGAAGTTTTGAAGGGATAGTGG + Intergenic
1159349456 18:67252894-67252916 CTGATGTTCATCAGGGATATTGG + Intergenic
1159430934 18:68352284-68352306 CTGCTATTCTTAAGAAATACTGG - Intergenic
1159743705 18:72206253-72206275 GTGCTGTTTTTAAGAGAAAGAGG - Intergenic
1161054778 19:2184871-2184893 CTCACGTTTTTAAGGGATAGTGG + Intronic
1161849380 19:6730839-6730861 CTGCTGTTGAGAAGGGATGGAGG - Intronic
1168380607 19:55918936-55918958 CTTATGTTCATCAGGGATAGTGG - Intronic
925579109 2:5392205-5392227 CTTCTGTTTTCAATGGATAGTGG - Intergenic
926533829 2:14085343-14085365 TTGATGTTCTTCAGGGATATTGG - Intergenic
927108777 2:19849539-19849561 CTGCTGTTCTGATAGGACAGGGG - Intergenic
928302270 2:30136173-30136195 TTCCTGTTCTTCAGTGATAGGGG + Intergenic
928470470 2:31570092-31570114 CTGATGTTCATCAGGGATATTGG - Intronic
928560240 2:32475413-32475435 TTGCTGTTGTTTAGGGATGGGGG + Intronic
928758644 2:34556069-34556091 CTGATGTTCATCAGGGATATTGG + Intergenic
929331205 2:40683261-40683283 CTGATGTTCATCAGGGATATTGG - Intergenic
929869671 2:45748022-45748044 CTGTTGTTATTAAGTTATAGGGG + Intronic
930092384 2:47540534-47540556 CTGCCTTTCTGAAGGGACAGTGG + Intronic
930222961 2:48763995-48764017 TTGATGTTCTTCAGGGATATTGG + Intronic
930228259 2:48816634-48816656 GTGCAGTTCTTAAGGGAGAAAGG + Intergenic
932404969 2:71506729-71506751 CTGAGGCTCTTAAGGGAAAGTGG - Intronic
933412848 2:81947607-81947629 CTGATGTTCATCAGGGATATTGG + Intergenic
936666387 2:114601472-114601494 CTTCTGTTTTAAAGGGATTGGGG + Intronic
939224595 2:139348856-139348878 CTGATGTTCATCAGGGATATTGG + Intergenic
939548447 2:143582948-143582970 CAGCTTTTCTTCAGGGATATGGG + Intronic
940272985 2:151911602-151911624 CTGATGTTCATCAGGGATATTGG + Intronic
942451140 2:176108458-176108480 CTCCTGCTTTTAAGGGAGAGAGG + Intronic
942669215 2:178355801-178355823 CTGATGTTCATCAGGGATATTGG - Intronic
942796477 2:179826358-179826380 CGGGTTTTCTTCAGGGATAGAGG + Intronic
947307997 2:228768344-228768366 CTGCTGTTCTTATGGTAATGAGG - Intergenic
947890491 2:233614480-233614502 TTGATGTTCATCAGGGATAGTGG + Intergenic
948694594 2:239726864-239726886 CTGCTGGTGTTCAGGCATAGCGG + Intergenic
1169243245 20:4002862-4002884 CTGGTGTTCTAAATGGATGGTGG + Intronic
1170892655 20:20389179-20389201 CTCCTGCTCATCAGGGATAGGGG + Intergenic
1171090449 20:22280607-22280629 CTGCTGTTGTTGTGGGAAAGTGG - Intergenic
1173296492 20:41763710-41763732 TTGATGTTCATAAGGGATATTGG + Intergenic
1173814139 20:45974221-45974243 CTGCTGGTTGCAAGGGATAGGGG - Intergenic
1176451323 21:6864500-6864522 CTGATGTTCATCAGGGATATTGG - Intergenic
1176791629 21:13325709-13325731 CCACTGTCCTTCAGGGATAGGGG + Intergenic
1176814918 21:13590358-13590380 CTGATGTTCATCAGGGATATTGG - Intergenic
1176829492 21:13729551-13729573 CTGATGTTCATCAGGGATATTGG - Intergenic
1177990149 21:28027607-28027629 CCACTGTCCTTCAGGGATAGGGG - Intergenic
1178244687 21:30939016-30939038 CTTCTGTTCTTTAGGGATAGGGG - Intergenic
1180724917 22:17939592-17939614 CTGTTCTTCATAAGGTATAGAGG - Intronic
1181947586 22:26530147-26530169 CTGTTGTTTTTAAGAGACAGGGG + Intronic
1182152623 22:28040301-28040323 CTGATGTTCATCAGGGATATTGG - Intronic
1184625609 22:45726079-45726101 CTGATGTTCATCAGGGATATTGG + Intronic
1185265252 22:49898757-49898779 TTTCTTTTCTTAAGAGATAGGGG + Intergenic
949131597 3:508554-508576 TTGATGTTCATCAGGGATAGTGG + Intergenic
949427813 3:3938291-3938313 CTGATGTTCCTCAGGGATATTGG + Intronic
951182822 3:19679101-19679123 TTGATGTTCATTAGGGATAGTGG + Intergenic
951296945 3:20949055-20949077 ATGGTGTTCTTCAAGGATAGTGG + Intergenic
951776796 3:26319360-26319382 CTGATGTTCATCAGGGATATTGG + Intergenic
953092254 3:39740392-39740414 TTGATGTTCTTCAGGGATATTGG + Intergenic
956943846 3:74196557-74196579 TTGATGTTCGTCAGGGATAGTGG + Intergenic
957061572 3:75485880-75485902 TTGATGTTCATCAGGGATAGTGG + Intergenic
957306471 3:78464329-78464351 TTGCTGTTCATCAGGGATATTGG + Intergenic
957786437 3:84888696-84888718 CTGATGTTCATCAGGGATATTGG - Intergenic
957973084 3:87407687-87407709 CTGATGTTCATAAAGGATATTGG - Intergenic
958162556 3:89835423-89835445 TTGATGTTCTTCAGGGATATTGG - Intergenic
958176256 3:89999671-89999693 TTGATGTTCTTCAGGGATATTGG - Intergenic
958523586 3:95223612-95223634 ATGATGTTCTTCAGGGATATTGG + Intergenic
958844403 3:99248778-99248800 CTGGTTTTCTTTAGGGAGAGAGG + Intergenic
959091479 3:101907844-101907866 CTGATGTTCATCAGGGATATTGG + Intergenic
959527763 3:107396961-107396983 CTCCTGGTCTGAAGGGAAAGAGG - Intergenic
959558212 3:107747825-107747847 CTGCTCTTCTAAAGGGATTGAGG + Intronic
960730685 3:120723512-120723534 TTGCTGTTCCTCAGGGATATTGG - Intronic
961175216 3:124829859-124829881 CTGCTGGTCTTAAAAGAGAGAGG - Intronic
961419330 3:126788252-126788274 TTGATGTTCTTCAGGGATATTGG + Intronic
962243746 3:133773880-133773902 CTGGTGTTTCTAAGGGAGAGAGG - Intronic
962376669 3:134864068-134864090 CTGTTGTTCTTAGAGGACAGAGG - Intronic
962736470 3:138329735-138329757 CTGCTGTTCTTATGGATTACTGG + Intronic
963349833 3:144138738-144138760 CTGCTGTTCTTAAGTCATGATGG + Intergenic
963527897 3:146437203-146437225 CTGATGTTCATCAGGGATATTGG + Intronic
963551457 3:146729190-146729212 TTGATGTTCTTCAGGGATATTGG - Intergenic
963637169 3:147812753-147812775 CTGATGTTCATTAGGGACAGAGG + Intergenic
964650838 3:159009494-159009516 CTGCTGTGCATTAGGGATACAGG - Intronic
965271399 3:166621134-166621156 CTGGTGTTCATCAGGGATATTGG - Intergenic
965322642 3:167267748-167267770 TAGTTGTTTTTAAGGGATAGAGG - Intronic
966574229 3:181481343-181481365 TTGATGTTCTTCAGGGATATTGG - Intergenic
970314162 4:14813504-14813526 TTGAAGTTCTTAAGGGATAGAGG + Intergenic
970762835 4:19512577-19512599 CTACTGTTGTTCATGGATAGGGG + Intergenic
974953494 4:68609439-68609461 TTGATGTTCTTCAGGGATATTGG + Intronic
975236202 4:71999758-71999780 CTGATGTTCATCAGGGATATTGG - Intergenic
975295917 4:72734270-72734292 CTGATGTTCATCAGGGATATTGG - Intergenic
977468943 4:97417980-97418002 TTGCTGTTCATCAGGGATATAGG - Intronic
977629787 4:99229553-99229575 CTGATGTTCATCAGGGATATTGG + Intergenic
978046574 4:104136354-104136376 TTGATGTTCTTCAGGGATATTGG + Intergenic
979337946 4:119485257-119485279 CTGATGTTCATCAGGGATATTGG - Intergenic
979373606 4:119918205-119918227 TTGATGTTCATCAGGGATAGTGG - Intergenic
981096251 4:140785097-140785119 CTGATGTTCATCAGGGATATTGG + Intergenic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
982733046 4:158977022-158977044 CTGATGTTCATCAGGGATATTGG + Intronic
982734223 4:158988452-158988474 CTGATGTTCATCAGGGATATTGG - Intronic
982838512 4:160153599-160153621 CTGATGTTCATCAGGGATATTGG + Intergenic
983173998 4:164566806-164566828 CTGATGTTCATCAGGGATATTGG - Intergenic
983927210 4:173415027-173415049 TTGCTGTTTTCAAGGGATATAGG - Intergenic
984427918 4:179611813-179611835 CTGATGTTCATCAGGGATATTGG - Intergenic
985204868 4:187524469-187524491 CTGATGTTCATCAGGGATATTGG - Intergenic
985237618 4:187893491-187893513 CGGCTGTTCTTATGGGAGTGGGG + Intergenic
987305630 5:16635035-16635057 TTGATGTTCTTCAGGGATATTGG + Intergenic
988029023 5:25738942-25738964 CAGCTGTGCATAAGAGATAGTGG - Intergenic
988059827 5:26152223-26152245 TTGATGTTCTTCAGGGATATTGG - Intergenic
988416407 5:30951689-30951711 TTGATGTTCTTTAGGGATATTGG - Intergenic
988618563 5:32798797-32798819 CTGATGTTCATCAGGGATATTGG - Intergenic
989236636 5:39155392-39155414 CAGCTATTTTTAGGGGATAGAGG + Intronic
989676371 5:43978279-43978301 CTGATGTTCATCAGGGATATTGG + Intergenic
991199336 5:63973242-63973264 TTGATGTTCATAAGGGATATTGG - Intergenic
991431353 5:66550913-66550935 CTGCAGATCACAAGGGATAGGGG - Intergenic
993134868 5:83947292-83947314 CTGCTGTTCTTAAGGGATAGAGG + Intronic
993420368 5:87694127-87694149 TTGATGTTCATCAGGGATAGTGG + Intergenic
994611280 5:102044182-102044204 CTGATGTTCATCAGGGATAATGG - Intergenic
996548228 5:124703758-124703780 TTGTTGTTTTTAAGGGACAGGGG - Intronic
996989742 5:129614249-129614271 CTGATGTTCATCAGGGATATTGG - Intronic
997450817 5:133981669-133981691 CTGCTCTTCCTAAGGGATGCTGG - Intronic
998003473 5:138642175-138642197 CGGCCTTTCTTAAGAGATAGGGG + Intronic
1000737662 5:164925741-164925763 CTGATGTTCATCAGGGATATTGG + Intergenic
1002850165 6:987472-987494 CTGATGTTCATCAGGGATATTGG + Intergenic
1004049071 6:12056317-12056339 ATGATGTTCTTAAGGAAAAGTGG + Intronic
1004469609 6:15917439-15917461 CTGGTGGTCTTAAGGCCTAGTGG - Intergenic
1004983733 6:21056949-21056971 TTGATGTTCATCAGGGATAGTGG + Intronic
1005152040 6:22762738-22762760 CTGATGTTCATCAGGGATATTGG + Intergenic
1005543910 6:26843579-26843601 CTGATGTTCATCAGGGATATTGG + Intergenic
1006487184 6:34352922-34352944 CTGTTGTTCTAAACTGATAGAGG + Intronic
1006561286 6:34914928-34914950 CTGCTGTGCTTAAGAGAACGTGG + Intronic
1006652843 6:35565777-35565799 CTGCAGTTTTTAGGGGGTAGAGG + Intergenic
1010482888 6:76375938-76375960 CTGATGTTCATCAGGGATACTGG + Intergenic
1011117437 6:83909076-83909098 CTGCTGTTCTGAAAGGTAAGTGG + Exonic
1012082728 6:94781864-94781886 CTGATGTTCATCAGGGATATTGG + Intergenic
1012572843 6:100752059-100752081 CAGCTGTTCTTAAGGGTAAGAGG - Intronic
1012766258 6:103370301-103370323 CTGATGTTCATCAGGGATATTGG - Intergenic
1012783418 6:103591806-103591828 CTGATGTTCATCAGGGATATTGG + Intergenic
1014088809 6:117379058-117379080 CAGCTGTTCTTCGGGGACAGAGG - Exonic
1014352844 6:120365452-120365474 CTGATGTTCATCAGGGATATTGG - Intergenic
1014422683 6:121264629-121264651 CTGATGTTCATTAGGGATATTGG - Intronic
1017808858 6:157969477-157969499 CTGCATTTCTTAAGGGATCTTGG + Intergenic
1020716384 7:11678912-11678934 CTGATGTTCATTAGGGATATTGG - Intronic
1021099575 7:16572367-16572389 CTGATGTTCGTCAGGGATATTGG - Intronic
1021984355 7:26084711-26084733 CTGCTCTTCTTAGGGCATGGAGG + Intergenic
1024380703 7:48692662-48692684 CTCTTGTTCTAAAGGGATTGTGG - Intergenic
1024624739 7:51196425-51196447 CTGATGTTCATCAAGGATAGTGG + Intronic
1024950115 7:54852107-54852129 CTGGTGTTCATCAGGGATAGTGG + Intergenic
1026032696 7:66808157-66808179 CTGTTGTTGTTAAGTGAAAGAGG + Intronic
1028337093 7:89671374-89671396 CTGATGTTCATCAGGGATATTGG + Intergenic
1028734479 7:94191770-94191792 CTGATGTTCATCAGGGATATTGG - Intergenic
1030451911 7:109722822-109722844 TTGATGTTCTTCAGGGATATTGG - Intergenic
1030508853 7:110457860-110457882 CTGGTGTTCATCAGGGATAGTGG - Intergenic
1031172159 7:118305726-118305748 CTGCTGAATTTAAGGAATAGGGG + Intergenic
1031699364 7:124904230-124904252 CTGATGTTCATCAGGGATATTGG - Intronic
1032003215 7:128279980-128280002 TTGATGTTCTTCAGGGATATTGG + Intergenic
1032072934 7:128820496-128820518 CTGGTGTTCTTAAAGGAGGGAGG - Intronic
1036558351 8:9880309-9880331 CTGATGTTCATCAGGGATATTGG - Intergenic
1036589721 8:10157837-10157859 CAGCTGTTATTAAAAGATAGAGG - Intronic
1037915936 8:22773561-22773583 CAGCTGTTCTGTAGGGAGAGGGG - Intronic
1040608225 8:48956328-48956350 TTGATGTTCTTCAGGGATAGTGG + Intergenic
1040993038 8:53372700-53372722 CTGATGTTCATCAGGGATATTGG - Intergenic
1043129094 8:76438847-76438869 CTGATGTTCATCAGGGATATTGG + Intergenic
1043604812 8:81987507-81987529 CTGATGTTCATCAGGGATATTGG + Intergenic
1044200396 8:89428390-89428412 CTGATGTTCATCAGGGATATTGG - Intergenic
1045794513 8:106027009-106027031 CTGATGTTCATCAGGGATATTGG - Intergenic
1046608245 8:116394451-116394473 CTGATGTTCATCAGGGATATTGG - Intergenic
1047452306 8:124975928-124975950 CTACTGTTCTTAATAAATAGTGG + Intronic
1047929884 8:129717044-129717066 TTGATGTTCTTCAGGGATATTGG + Intergenic
1049476619 8:142799895-142799917 CTGTTGCTCTCAAGGGCTAGGGG - Intergenic
1050528000 9:6562964-6562986 GTGCTGTGCTTCAGGGAGAGGGG - Intronic
1050632638 9:7576846-7576868 CTGATGTTCATCAGGGATATTGG + Intergenic
1050965355 9:11795036-11795058 CTGCTGTGCTAAAGGGTCAGAGG + Intergenic
1051940985 9:22505304-22505326 CTGATGTTCATCAGGGATACTGG + Intergenic
1054942404 9:70757551-70757573 CTGATGTTCATCAGGGATATTGG - Intronic
1055325397 9:75123086-75123108 TTGCTGTTCTTCAAGGAGAGAGG + Intronic
1057745460 9:97747501-97747523 CTGTTGTTATTAAGAGAAAGAGG - Intergenic
1059954932 9:119505887-119505909 CTGATGTTCATCAGGGATATTGG - Intronic
1062252082 9:135603310-135603332 ATGCAGTTGTTTAGGGATAGGGG - Intergenic
1203517858 Un_GL000213v1:20017-20039 CTGATGTTCATCAGGGATATTGG + Intergenic
1203532440 Un_GL000213v1:159077-159099 CTGATGTTCATCAGGGATATTGG + Intergenic
1185529901 X:809325-809347 CTGCTGCTAATAAGGGGTAGTGG - Intergenic
1187635266 X:21221044-21221066 CTGATGTTCATCAGGGATATTGG + Intergenic
1188119192 X:26283727-26283749 CTGATGTTCATCAGGGATATTGG + Intergenic
1190309787 X:49109001-49109023 CTGCTGTTATTATGGGAGTGGGG + Intergenic
1191186393 X:57617442-57617464 CTGATGTTCATCAGGGATATTGG - Intergenic
1191738533 X:64412941-64412963 CTGATGTTCATCAGGGATATTGG + Intergenic
1191771264 X:64761428-64761450 CTGATGTTCTTCAGGGATATTGG + Intergenic
1192228758 X:69248767-69248789 CTGATGTTCATCAGGGATATTGG - Intergenic
1192758862 X:74074420-74074442 TTGCTGTTCATCAGGGATATTGG + Intergenic
1192982535 X:76361475-76361497 CTGATGTTCATCAGGGATATTGG + Intergenic
1193233341 X:79075278-79075300 TTGATGTTCTTGAGGGATATTGG - Intergenic
1193351163 X:80466276-80466298 CTGATGTTCATCAGGGATATTGG - Intergenic
1193830271 X:86281214-86281236 CTGATGTTCATCAGGGATATTGG - Intronic
1195213864 X:102677170-102677192 TTGATGTTCATAAGGGATATTGG + Intergenic
1195579882 X:106489556-106489578 CTGATGTTCATCAGGGATATTGG + Intergenic
1195762589 X:108262846-108262868 CTGATGGTCTTAAGAGACAGAGG - Intronic
1196159354 X:112465536-112465558 TTGATGTTCTTCAGGGATATTGG - Intergenic
1197061982 X:122192047-122192069 CTGATGTTCATCAGGGATATTGG + Intergenic
1197684262 X:129422048-129422070 CTGATGTTCATCAGGGATATTGG + Intergenic
1198091858 X:133339285-133339307 CTGCTGCTCTCAAGAGATGGAGG - Exonic
1198707673 X:139466683-139466705 CTGCTGTTCTCCAAAGATAGGGG - Intergenic
1201419174 Y:13779279-13779301 CTGATGTTCATCAGGGATATTGG + Intergenic
1201537360 Y:15065522-15065544 CTGATGTTCATCAGGGATATTGG + Intergenic
1201750011 Y:17422006-17422028 CTACTGTTTTTAAGGGACATAGG + Intergenic