ID: 993138253

View in Genome Browser
Species Human (GRCh38)
Location 5:83997828-83997850
Sequence AGGGAGAATGAAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 6, 2: 40, 3: 119, 4: 482}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993138243_993138253 24 Left 993138243 5:83997781-83997803 CCTTCATAAGAACCAAAAATCAG 0: 229
1: 464
2: 491
3: 390
4: 488
Right 993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG 0: 1
1: 6
2: 40
3: 119
4: 482
993138245_993138253 12 Left 993138245 5:83997793-83997815 CCAAAAATCAGGTGAGTGATCAG 0: 1
1: 51
2: 116
3: 230
4: 566
Right 993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG 0: 1
1: 6
2: 40
3: 119
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993138253 Original CRISPR AGGGAGAATGAAGTGATTGT GGG Intronic
903187175 1:21635263-21635285 AGGGACAATGAGGTCAATGTAGG - Intronic
903448685 1:23438118-23438140 ATGTAGAATGAAGAGTTTGTGGG - Intronic
904030745 1:27532147-27532169 AGGGAGAGGGAAGTGATGGTAGG - Intergenic
904117727 1:28174873-28174895 AGGGAGGATGAAGTAAGAGTTGG - Intronic
904384495 1:30132519-30132541 AGGGTGAATGATGTGAGTGCTGG - Intergenic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906634471 1:47399479-47399501 AGGAAGAGGGAAATGATTGTTGG + Intergenic
906702253 1:47868368-47868390 AGAGAGAATGAGGTCATGGTTGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907888879 1:58619444-58619466 AGAGAGCATGAAGTTATTGCAGG - Intergenic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
908478865 1:64517418-64517440 AAGGAGAATTAAGTGAGTGTGGG + Intronic
909209810 1:72808753-72808775 AGGGGGAAGAAAGTGATTGTGGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909702614 1:78544009-78544031 AGGGAGGATGAGGTAATGGTTGG + Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910223898 1:84917017-84917039 AGGGAGAGTGAACTGATGGGAGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910851948 1:91657261-91657283 AGGGAGAATGTAGTGGGTGTTGG - Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911298203 1:96143004-96143026 AGAGAGAATGGAGTAATTGGTGG - Intergenic
911716486 1:101139281-101139303 AGGGAAAAGGAAGTGAGTTTGGG - Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912855581 1:113166184-113166206 AAGGTGACTGAAGTGATTGAAGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
912932027 1:113972765-113972787 AGGGAGAATCAAGAGATCATAGG - Intronic
913442691 1:118915655-118915677 AGGAAGAAAGAACTGATTTTCGG - Intronic
913705890 1:121422724-121422746 AGGGAAAAAGAAGTGATTCAGGG + Intergenic
914837374 1:151218887-151218909 AGGGATCATGAATTGAATGTGGG + Intronic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915087440 1:153397992-153398014 AGTGAGGGGGAAGTGATTGTTGG - Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918276127 1:182955268-182955290 TGGGAGAAGGGAGTCATTGTAGG - Intergenic
918316454 1:183326649-183326671 AGGGAAAAAGAAGTCATTGGGGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918892707 1:190295753-190295775 AGGGAAAGGGAAGTGAGTGTGGG - Intronic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919959806 1:202455367-202455389 AGGGGGAATAAGGAGATTGTGGG - Intronic
920097266 1:203494296-203494318 AGGGAAAATGAAGAGAGTTTAGG + Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
923430862 1:233919203-233919225 AGGGAGAATGGTGTGAATTTTGG + Intronic
923836107 1:237613041-237613063 AGGAAGAATGAAATTAATGTGGG - Intronic
923971966 1:239213638-239213660 AGGAAGAAAGAAGTAATTGGTGG + Intergenic
924056821 1:240132397-240132419 AGAGAGAATGAATTCATTGGTGG + Intronic
924250901 1:242132173-242132195 AAAGAGAATGCAGTGATTGCGGG + Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
1063056348 10:2509088-2509110 AGGGAGAGTGGAGTGAATCTTGG + Intergenic
1063126479 10:3140861-3140883 ATAGACAATGAAGTAATTGTTGG + Intronic
1064446466 10:15398348-15398370 AGGGAGAGTGAAGCAATTGGAGG + Intergenic
1064950272 10:20840995-20841017 GGGGAAAATGAAGTGTCTGTAGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066203059 10:33160348-33160370 AGTGAGAATGTAGGGAATGTGGG - Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1066694331 10:38064548-38064570 AGAGAGAAGGAAGTGATTCTTGG - Intronic
1066985600 10:42463893-42463915 ATGGAGAATGAAAAGATTGGTGG + Intergenic
1066998187 10:42582628-42582650 ACAGAGAAGGAAGTGATTCTTGG + Intronic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067070030 10:43124492-43124514 AAGAAGAATGAATTGATTGAGGG - Intronic
1067279963 10:44863829-44863851 GAGGAGAATGAAGTGGGTGTGGG - Intergenic
1067327009 10:45279130-45279152 AGGAAGAAGGGAGTGGTTGTTGG - Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069250486 10:66260301-66260323 AGGGAGAATGAATGGATTGGAGG - Intronic
1069336297 10:67355294-67355316 AGGCAGAAGGAAGTAGTTGTTGG + Intronic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1072844398 10:98813484-98813506 ATGGAGAAGGCAGTGATTTTGGG - Intronic
1072861724 10:99013407-99013429 AGGAAGAACGAAGAGATTCTTGG + Intronic
1073808483 10:107126202-107126224 AGATAGGATGAAGTGATCGTTGG - Intronic
1074172683 10:110958801-110958823 AGGGAGAAGGAAGGGATTCAGGG - Intronic
1074280265 10:112044873-112044895 AGTGAGTTTGAAGTGCTTGTGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074921215 10:118015480-118015502 AGGGAGAATTAAGTAAATTTAGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076709126 10:132321491-132321513 AGGGTGAATGAAGTGGCTCTGGG - Intronic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1078953171 11:16158594-16158616 AGGCAAAATGAAGAAATTGTAGG + Intronic
1080618630 11:33967953-33967975 AGGGAGAATGAAGAAAATGCTGG - Intergenic
1080966640 11:37220567-37220589 AGAGAGAATGCAGTGATCGTGGG - Intergenic
1081002156 11:37688338-37688360 ATAGAGAAAGAAGTGATTTTTGG + Intergenic
1081589595 11:44411991-44412013 AGGGAAAATAAAGAGATTATAGG - Intergenic
1081884663 11:46484738-46484760 AGGGAGAATGATGTGAATCCGGG - Intronic
1082631442 11:55546858-55546880 AGGAGGAAGAAAGTGATTGTTGG + Intergenic
1082654304 11:55834477-55834499 AGGGAGAAGGGGGTGATTGTCGG - Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1085031249 11:73272160-73272182 AGGGTGAATGAAGTGACTTGCGG + Intronic
1085053021 11:73389369-73389391 ATGGAGAATGAAGGGCTTGCTGG + Intronic
1085418608 11:76336744-76336766 AGGGAGGAGGAAGTGATAGGTGG + Intergenic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085807185 11:79647225-79647247 AGGGTGAATTAAATTATTGTCGG + Intergenic
1085826518 11:79853427-79853449 AGGGACAATGATGTGTCTGTGGG - Intergenic
1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG + Intergenic
1087522115 11:99252069-99252091 AGGGAGAATCAAGAGAATGATGG - Intronic
1087874549 11:103339967-103339989 AGCAAGAGTGAAGTGAGTGTGGG - Intronic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089665940 11:120019350-120019372 AGGGCGCATGAACTGATGGTTGG - Intergenic
1089843138 11:121436183-121436205 AGGAACAATGAAGTGATTAAGGG + Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1091565914 12:1647721-1647743 AGGGAGGAAGGAGTGATTGAGGG + Intergenic
1092173658 12:6388772-6388794 ATGGAGAATGAAATGGGTGTAGG - Intronic
1093393165 12:18648616-18648638 AGTGACAATGAATTGATTGGTGG - Intergenic
1093952132 12:25175167-25175189 AGTGAGAATGAAATAGTTGTGGG - Intronic
1095719532 12:45385691-45385713 AGGGGAAATGAAGTGAGTATTGG - Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096252895 12:50044694-50044716 AGGGAAGATAAAGTGATGGTGGG - Intergenic
1097475492 12:60051022-60051044 TGGGAGAAGGAAGTGATATTTGG + Intergenic
1097626133 12:62002734-62002756 AGGGAGTATGATATGATTATTGG - Intronic
1098175068 12:67781685-67781707 TGGGGAAATGAAGTGGTTGTGGG - Intergenic
1098419114 12:70272740-70272762 AGGGAGAGTGAAGGGATTAGAGG - Intronic
1098739322 12:74151869-74151891 AGGGAGAAAAAAGTCATTGTGGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099935864 12:89124577-89124599 AGGGAGAATGAAGTGTGTATTGG - Intergenic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1103063215 12:117875608-117875630 AGGGAGAAGGCAGCGATTATGGG - Intronic
1104268728 12:127262825-127262847 AGGCAGAATGGAGAGATTGGAGG - Intergenic
1105553774 13:21426253-21426275 TGGTAGACTGAAGTGGTTGTTGG - Intronic
1105601659 13:21893225-21893247 AGGGAAAATCAAGTGATGGTGGG + Intergenic
1106141061 13:27012066-27012088 AAGGAGAGTGAAGTGAATGGAGG + Intergenic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107765752 13:43732797-43732819 AGAGAAAATGCAGTGAGTGTTGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1109561032 13:64050426-64050448 AGGGACCACGAATTGATTGTAGG + Intergenic
1110419433 13:75288639-75288661 AGGGAGGAGGAATTGAATGTAGG - Intronic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111550986 13:89812215-89812237 AGGGAGAAAGAAGAGAAAGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1111800077 13:92970341-92970363 AGGAAGAATTAAGTGAGTGTGGG + Intergenic
1111992832 13:95133806-95133828 AAGGAGAATGAAGAGGATGTGGG + Intronic
1113160421 13:107374213-107374235 GGGGAGAATGATGTGTTTGTGGG - Intronic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1114269810 14:21093767-21093789 AGGGAGAATGGATTGGTTTTGGG - Intronic
1114994289 14:28328467-28328489 AGAGAGAGTGAAGTGATCCTGGG - Intergenic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1116350717 14:43859210-43859232 AGAGAGAAGGAAGTGAGTTTAGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117212364 14:53513716-53513738 AGGAAGGATGAAGTCATTGAGGG + Intergenic
1117499315 14:56336533-56336555 AAAGAGAATGAAGTGATTATAGG - Intergenic
1117870657 14:60197452-60197474 AGGGAGGACAAAGTGACTGTGGG + Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118662462 14:68029045-68029067 AGGGTTAATGAAGAGACTGTGGG - Intronic
1119475741 14:74926640-74926662 AGGGGGAATGAAGATGTTGTGGG - Intergenic
1119636564 14:76278112-76278134 AGAGGGAAGGAAATGATTGTAGG + Intergenic
1119670445 14:76514287-76514309 AGGGAGATTGGATTGAATGTGGG + Intergenic
1120622044 14:86776043-86776065 GGGCAGAATGATGTGACTGTTGG + Intergenic
1121862071 14:97327764-97327786 AGGAAGAAGGAAGTCATTCTGGG - Intergenic
1124086561 15:26556029-26556051 AAGTAGAAAGAAGCGATTGTGGG + Intronic
1124947202 15:34280016-34280038 AGACAGAGTGAAATGATTGTGGG + Intronic
1126489145 15:49216808-49216830 AGGGAGGGTGAAGTGAGTGTGGG - Intronic
1126660829 15:51031470-51031492 AGAGGGACTGCAGTGATTGTGGG - Intergenic
1126979948 15:54229156-54229178 AGAGAGAATGCAGTAATTGCAGG - Intronic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1127992591 15:64131825-64131847 AAGGAGGAAGAAGTCATTGTTGG - Exonic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1133307956 16:4822973-4822995 AGGGAGAAGGAAGTGACCTTTGG - Intronic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1134796165 16:17038963-17038985 AAGGAGAATGTAGTGCATGTGGG - Intergenic
1135025158 16:18994012-18994034 TGGGGAAATGAAGTGAATGTCGG + Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140977090 16:80070382-80070404 AGGGAGAAGGATGTGAATGAGGG - Intergenic
1141376604 16:83536490-83536512 AGTGGGAATGCAGTGAGTGTGGG + Intronic
1141795627 16:86271671-86271693 AGGATGAAGGAAGTGTTTGTGGG + Intergenic
1142417660 16:89951670-89951692 GGGGAGAGTGACGTGATTGCAGG - Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1142943327 17:3402210-3402232 AGGGTGAATGAGCTGATTCTTGG - Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145960599 17:28884574-28884596 AAGTAGAAAGAAGTGGTTGTGGG + Intronic
1147324009 17:39661812-39661834 AGGGAGAATGAAATGGTGATGGG + Intronic
1148031872 17:44627586-44627608 GGGGTGACTGAAGGGATTGTGGG - Intergenic
1148839512 17:50485792-50485814 AGGGGGAAGGAAGTGAGTGAGGG - Exonic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149370054 17:55985034-55985056 AGGGAGAAAGGAGTGATCATGGG + Intergenic
1149414247 17:56442463-56442485 AAGGAGAATGATGTGAGAGTGGG + Intronic
1149466431 17:56883550-56883572 AAGGAGAATGAAGAGACTGAGGG + Intergenic
1149888395 17:60363879-60363901 AGGGAGAAAGAAGGAAGTGTTGG + Intronic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150384964 17:64751447-64751469 AGGGAAAAGGAAGTGGATGTGGG - Intergenic
1150550245 17:66203450-66203472 AGGGAGTGTGAACTGTTTGTTGG + Intergenic
1151138486 17:71970127-71970149 AAAGAGAATGAAGTGGTAGTGGG + Intergenic
1152473773 17:80504321-80504343 AGGGTGAATGAAGGGATGGGTGG + Intergenic
1153088511 18:1317650-1317672 AGGAAGAGTGAAGTGATCATGGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153400197 18:4676839-4676861 AGGAAGAATAAAGTAATCGTAGG + Intergenic
1153647962 18:7212010-7212032 ATGGATAATGAAGTTATTCTTGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1156860732 18:41833427-41833449 ATGGAAAAAGAAGTGACTGTTGG + Intergenic
1156871330 18:41948906-41948928 AAGAAGAAAGAAGTGCTTGTTGG - Intergenic
1157492064 18:48130387-48130409 AGGGAGAAGAAAGTGATGCTAGG + Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158526776 18:58221496-58221518 AGGTAGAAAGAAATGCTTGTTGG - Intronic
1158716482 18:59884797-59884819 AAGGAGAATGGAGTGGTTGGTGG - Intergenic
1159135013 18:64327275-64327297 AAGGAGAATGAAATAAGTGTAGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1162905939 19:13824075-13824097 AGGGAGAAAGGAGAGATAGTAGG + Intronic
1163184027 19:15623834-15623856 GGGCAGAATGAAGTGATTCAGGG - Intronic
1164019830 19:21290779-21290801 AAGGAGAATGGCGTGAATGTGGG + Intronic
1164588273 19:29491275-29491297 AGTGAGAACAAAGTGATTCTGGG + Intergenic
1165325173 19:35110161-35110183 AAGGAGAAGGAAGACATTGTGGG + Intergenic
1167007823 19:46787147-46787169 AGGGAGAAGAAAGTGATTTGGGG - Intronic
1168448961 19:56448178-56448200 AGGAAGAATGGAGTGATGGTGGG + Intronic
1168570751 19:57466856-57466878 AGAGAGCACGAAGTGAGTGTGGG - Intronic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
926000449 2:9327369-9327391 AAGGAAAATAATGTGATTGTTGG - Intronic
926318041 2:11725803-11725825 AGGGAGAAAAAAGTGATTCCGGG - Intronic
926979768 2:18556291-18556313 AGGGAGAAATATGGGATTGTAGG - Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928499491 2:31875586-31875608 AGGTAGAATGAAGTGGATGGAGG - Intronic
928603997 2:32927361-32927383 AGGCAGCATGAAGGGACTGTTGG + Intergenic
929450678 2:42035013-42035035 AGAGAGAATGAAGTTTTTGGGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931012736 2:57936012-57936034 GGGGAGAAGGAAGTGATGGTAGG + Intronic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
931882809 2:66583722-66583744 AGGGAGAAGGAGGTGCGTGTGGG + Intergenic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
932998627 2:76891080-76891102 AGGAAGAATGAAGTGAAAGGAGG + Intronic
933313990 2:80693918-80693940 AGGGTGGAGGAAGTGATTTTAGG + Intergenic
933340088 2:81013490-81013512 GGGGAGAATGAAGGGATTTTGGG - Intergenic
933999106 2:87691970-87691992 AGTGAGAATGAATAGATGGTGGG - Intergenic
934776499 2:96941170-96941192 TGGGAGGAGGAAGTGGTTGTGGG + Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935018945 2:99212132-99212154 AGGGAGAATGAAGTGATCATGGG - Intronic
935105822 2:100042319-100042341 AGAGAAAATGAAGTGAGTGCGGG - Intronic
935263310 2:101373729-101373751 AGGGAGAAAGAAGTGACTGCAGG + Intronic
935805632 2:106744835-106744857 AAGGAAAATGAAGTGAGTGTTGG - Intergenic
936237169 2:110752525-110752547 AGAGAGAAAGTAGTGATTGAGGG + Intronic
936294736 2:111258921-111258943 AGTGAGAATGAATAGATGGTGGG + Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936840634 2:116764289-116764311 AGGAAGAATGAAGGGAAAGTGGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
939501345 2:142988912-142988934 AGGGACAATGAAGTGATGACTGG - Intronic
940263702 2:151814195-151814217 AGGAAGAACGAAGAGATTCTTGG + Exonic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941525478 2:166601403-166601425 AGGGAGAGTGAGGGGCTTGTGGG + Intergenic
941707003 2:168669495-168669517 AGGGAGAATGATGTTGGTGTAGG + Intronic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942434428 2:175956319-175956341 AGGGAGAATGATCAGATTTTTGG - Intronic
942793330 2:179786635-179786657 AGGGAAGATGAAGTGGTTTTAGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944818347 2:203402854-203402876 TGGGAGAATGAATGAATTGTAGG + Intronic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
945802365 2:214449442-214449464 TGGGAGAAAAAATTGATTGTAGG + Intronic
946140937 2:217690119-217690141 AGGGAGTATTTAGTGATGGTGGG - Intronic
946367324 2:219256872-219256894 GGTCAGAATGATGTGATTGTTGG + Intronic
946508175 2:220324102-220324124 TGGGAGAGTGATGTGATTGATGG + Intergenic
946509199 2:220335745-220335767 AGGAAGAATGTGGTAATTGTGGG - Intergenic
946983855 2:225249316-225249338 AGGCAGAATGAAGGGAGTCTGGG - Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947691969 2:232146762-232146784 AGGAAGACAGAAGTGAATGTTGG + Intronic
948058931 2:235029545-235029567 AGAGAGAATGGTGTGTTTGTGGG - Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169597185 20:7213871-7213893 AGGGAGCACAAAGGGATTGTGGG + Intergenic
1169602214 20:7274572-7274594 AGGGAGAAGGGAGAGATTCTGGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170051628 20:12152108-12152130 AGACACAATGAAGTGGTTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1172171040 20:32932507-32932529 AGGGAGCATGAACTGTTTGGGGG - Intronic
1173107611 20:40152479-40152501 AAGGAAAATGATGTGATTCTTGG + Intergenic
1173325116 20:42026190-42026212 AGGGAGCAGGGAGTGATTGGAGG + Intergenic
1174613725 20:51820012-51820034 GGGGAAAATCAAGCGATTGTTGG + Intergenic
1174644154 20:52071189-52071211 AGGGAGAATGTAGTGATCCAGGG + Intronic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177849725 21:26332458-26332480 AGAGAGAGTGTAGTGATTCTGGG + Intergenic
1177904282 21:26956572-26956594 AGAGATAGTGAAATGATTGTGGG - Intronic
1179442904 21:41407961-41407983 AGGGAGAAAGAAGGGTTTGCTGG - Intronic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1182340618 22:29617550-29617572 AGGGAGAAAGAGGAGATTGGAGG - Intronic
1182357991 22:29730829-29730851 AGGGAGAAGGGAGTGAGCGTGGG + Exonic
1182432421 22:30307771-30307793 GGGGAGAATGATGTTATAGTAGG - Intronic
1182490956 22:30671493-30671515 AGAGAGAATGAAATGAATATGGG - Intergenic
1182785276 22:32902300-32902322 AGGGAGAATGTAGTCAGTGAGGG + Intronic
949709291 3:6855908-6855930 AGGGAGACTGAAAGGATTATAGG + Intronic
949840543 3:8315382-8315404 AGGGAAAAGGAATTAATTGTTGG + Intergenic
950790382 3:15466915-15466937 AGGGGGAAGGAAGAGATTTTGGG - Intronic
950958546 3:17080438-17080460 AAGAAGAATGAATGGATTGTAGG - Intronic
951125961 3:18983384-18983406 AGGGAGAGAGACATGATTGTGGG - Intergenic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951421965 3:22497239-22497261 AGGGAAAATGAAGAGATTCCAGG - Intergenic
951617627 3:24566176-24566198 AGGGAGAAAGAAGAGGATGTAGG - Intergenic
952410719 3:33047561-33047583 TGTGAGAATGAAGTTATTTTAGG + Intronic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
953753868 3:45630421-45630443 AGTGAGAGGGAAGTGTTTGTGGG + Intronic
953790445 3:45943292-45943314 AAGCAGAATGAAGGGAGTGTGGG + Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954570698 3:51638410-51638432 AGGGAGAATAAAGTGAGAGGGGG + Intronic
954805551 3:53217988-53218010 GGGGACAATGAAATGAGTGTGGG - Intergenic
955123307 3:56083691-56083713 TGGGAGAATGAAGTGGGGGTTGG + Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955790375 3:62582904-62582926 AGAGTGAATGAAGAGAATGTGGG + Intronic
956059919 3:65339019-65339041 TGGGAGAATTAACTGATTGACGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959306834 3:104677980-104678002 AGGGAGAGTGAAGAGATAGTGGG + Intergenic
959716769 3:109442442-109442464 AGGGAGACTGCAGCAATTGTGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
960473925 3:118100659-118100681 GGGGAGCATGAAATGATTCTAGG - Intergenic
960948231 3:122981527-122981549 AGAGAGTAGGAAGTGAGTGTAGG - Intronic
961199453 3:125032718-125032740 AGACAGAGAGAAGTGATTGTAGG + Intronic
961225107 3:125237105-125237127 AGGGAGACTGAATTGACTGAAGG + Intronic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
961975298 3:131018078-131018100 AGCAAGAATGTAGTGGTTGTAGG + Intronic
962106727 3:132397374-132397396 AGTGAAAATAAAGTGATTGGAGG + Intergenic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964253588 3:154749446-154749468 AAGGAGAATGCAATGATTATGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965096536 3:164235533-164235555 GGGGAGAAGGAAGTGAGTATAGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965759734 3:172062879-172062901 ATGAAGAATTAAGTGAATGTAGG + Intronic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
965853942 3:173065698-173065720 AGGGAAAGTAAAGTGAGTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966865230 3:184255177-184255199 GGGGGTAATGAAGGGATTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968351470 3:198057296-198057318 AGTGGGAATGAAGTGAGTATGGG - Intergenic
970887637 4:21004938-21004960 AGAGAGGAAGAAGTGAATGTAGG + Intronic
970891881 4:21055640-21055662 AGGGAGAATGAATTAAATATAGG - Intronic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
971307559 4:25496828-25496850 AGGGAGAAAGAACGGAGTGTGGG + Intergenic
972032670 4:34480894-34480916 AGGTAGAAGGAACTGATTGGAGG + Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973007309 4:45029147-45029169 ATGGAGAATGATGTCATTGGAGG + Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
975095753 4:70454453-70454475 AGGGAGCATGCAGTGCCTGTGGG - Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975695219 4:77006164-77006186 AAGCAGTATGAAGTGATTGATGG - Intronic
975705939 4:77112152-77112174 AGGAAGGATGAAGTGATACTGGG - Intergenic
975904945 4:79198423-79198445 AAGAAGAATTAAGAGATTGTTGG + Intergenic
975930464 4:79515619-79515641 AGGGAGAATGAAGGGCTCATGGG - Intergenic
976776179 4:88708707-88708729 AGGAAGAATGAAGTTTTTGAAGG + Intergenic
977078805 4:92495415-92495437 AGGTAGAATGAAATAATTTTAGG + Intronic
977153275 4:93541413-93541435 AGTGAGAGTTAAGTGATTCTTGG + Intronic
977591024 4:98827409-98827431 AGGGAACATGAAGGGATTGCTGG - Intergenic
977616190 4:99089410-99089432 AGAGAGAATGTAGTATTTGTCGG + Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978387864 4:108193797-108193819 AGTAAGAATGAAGTGACTGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980222414 4:129936119-129936141 GAGGATAATGAAGAGATTGTAGG - Intergenic
980667859 4:135961835-135961857 AGGGAGCATGAAATGTTTGTTGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
982057891 4:151571288-151571310 AGGTAGAAAGAAGTCATTCTGGG - Intronic
982077649 4:151753897-151753919 ATGGAGGAAGAAGTGAGTGTGGG - Intronic
982126487 4:152188335-152188357 AGCGAGAGTCAAGTGATTGCAGG - Intergenic
982427113 4:155277401-155277423 AGAGTGAATGAAGTGGATGTGGG - Intergenic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
983050046 4:163035421-163035443 AGGGAGATTGATGTGAATGAAGG + Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983772338 4:171567142-171567164 AGGGAGATTGAAGTGGTTTTAGG - Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
985613576 5:905468-905490 AGGGAGTCTGAAGTGACTGAAGG - Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986541294 5:8846964-8846986 AAGAAGAATGAAGTAAATGTAGG + Intergenic
986629940 5:9762014-9762036 AGTGACAAGGAAGTGATGGTGGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988616898 5:32783578-32783600 AGGGAGAACAAAGTGAATATAGG + Intronic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
990251430 5:53919524-53919546 AGTGAGAAGAAAGTGATTGAGGG + Intronic
990321824 5:54637490-54637512 AGGAGGAATGAAGTGGTGGTGGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991483012 5:67103597-67103619 AGAGAGAATGAAATGAAAGTTGG + Intronic
992400465 5:76406448-76406470 TGGAAGAAGGAAGTGATAGTAGG + Intronic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993252514 5:85547858-85547880 AGGGAGAAGGAAGTGAGTGTAGG + Intergenic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995697908 5:114900389-114900411 AGGAAGAGTGTTGTGATTGTGGG - Intergenic
996438557 5:123463191-123463213 GGGGAAAATGAGGAGATTGTTGG - Intergenic
996582245 5:125044422-125044444 AAGGAGAACGAAGTGGATGTTGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
998182362 5:139954366-139954388 AGGAAGAATGAAATGACTGGAGG + Intronic
998888745 5:146723420-146723442 AGGGAGAATTAAGTAAGAGTGGG + Intronic
999308364 5:150535375-150535397 AGGTAGAATGAAGAGAAGGTAGG + Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
999806048 5:155082330-155082352 AGAGAGAATAAAGGGATTGAAGG + Intergenic
1000063371 5:157675247-157675269 AGGGAGAATGAAATGAATATGGG - Intronic
1000422076 5:161049428-161049450 AGGCAGAATGTAGTTATTGGTGG + Intergenic
1000489860 5:161898262-161898284 AATGAGAATTAAGTGAGTGTTGG - Exonic
1001067952 5:168554646-168554668 AAGGAACATGAAGTCATTGTAGG - Exonic
1001370034 5:171190576-171190598 AGGGAACTTGAAGTGATTCTTGG - Intronic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1003425997 6:5998924-5998946 CGGGAGCATGGAGTGAGTGTGGG + Exonic
1003738049 6:8900297-8900319 TGGGAGAATGAATTAATTGTTGG + Intergenic
1004239381 6:13905081-13905103 AGACAGCAAGAAGTGATTGTTGG - Intergenic
1004762498 6:18684129-18684151 AGGGAGAAGAAAGTGAGTGAAGG - Intergenic
1005774023 6:29109517-29109539 AGGAAGAAAGAAATCATTGTGGG - Intergenic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1008394320 6:50989417-50989439 AGGGAGAATTATGTCAGTGTTGG + Intergenic
1008524714 6:52396581-52396603 TTGGAGAATGAAGTGAGGGTTGG + Intronic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009045987 6:58237895-58237917 AGGGTGAATGAAGGGACTGGAGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009403903 6:63289750-63289772 AGGGAGATTGAAGAGATGTTTGG + Intronic
1009516396 6:64624418-64624440 ATAGAGTATGAAGTGTTTGTGGG + Intronic
1009596293 6:65740826-65740848 AGGAAGAGTGAAATGATTGATGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009744737 6:67798298-67798320 AGGGAAATTGGAGTGGTTGTGGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010455165 6:76045892-76045914 AATGAGAATGAATTGATAGTTGG + Intronic
1010575846 6:77529779-77529801 AGGGAGAAGGATGTGATAGGTGG - Intergenic
1010980892 6:82367240-82367262 AAGGCTAATGAAGTTATTGTTGG + Exonic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011181160 6:84622430-84622452 AAGGAGAATGAGGAGTTTGTGGG - Intergenic
1011334790 6:86248399-86248421 ACAGAGAATGAAGTTGTTGTGGG + Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1012431412 6:99167470-99167492 TGGGGGAATGAAGTGATATTCGG + Intergenic
1012464372 6:99501191-99501213 AGGGTTAAGGAGGTGATTGTGGG - Intronic
1013974828 6:116065079-116065101 AGGAAGACAGAAGTGATTTTTGG - Intergenic
1014794606 6:125710324-125710346 AGGGAGAACGCAGGAATTGTGGG + Intergenic
1015246864 6:131084688-131084710 AACGAGAATGAACTGACTGTAGG - Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017274730 6:152553246-152553268 GAGTAGAATGAAGTGATTGAAGG - Intronic
1017650389 6:156576169-156576191 GGGGAGAGTGAAGTGAGTGTGGG + Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022827523 7:34030959-34030981 AGGAAGACTGAGGTGAATGTTGG + Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026426453 7:70299273-70299295 AGGCACAAGGAAGAGATTGTAGG - Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028079797 7:86561255-86561277 AGAGAGAAAGATGTGATTTTAGG - Intergenic
1028266700 7:88734305-88734327 AGGAAGACTGTAGTGATTATGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029350100 7:100007329-100007351 AGAGAGAATAAAGTGGTTGGGGG - Intergenic
1030396191 7:108989333-108989355 AGGGAAAATGAATTTATTGATGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031021763 7:116636217-116636239 GGGGAGGGAGAAGTGATTGTTGG - Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031565838 7:123296173-123296195 AGGGAGAGTAAAGTGATGATGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1032301772 7:130694286-130694308 AAGGAGAATGAAGAGAGTGGAGG - Intergenic
1032669179 7:134067812-134067834 AGGTAGAAAGAAGTGCTTGTGGG - Intergenic
1032677789 7:134147565-134147587 AGAGAAAATGAAATGGTTGTGGG + Intronic
1032729849 7:134629739-134629761 CTGGAGAATGAATTGATTGCTGG + Intergenic
1033410836 7:141116092-141116114 AAAGAGAATGAAGTCAGTGTGGG - Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1033927396 7:146480322-146480344 AAGGAGAATGATTTGATTATAGG + Intronic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034589218 7:152125806-152125828 ACGGATAATGAATTGATTGGTGG + Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1034883689 7:154781373-154781395 AGGGAGAACGAAGTGAGAGGGGG - Intronic
1036227985 8:6975970-6975992 AGGTAGAATGAAATGTTTGGTGG - Intergenic
1036230438 8:6995087-6995109 AGGTAGAATGAAATGTTTGGTGG - Intergenic
1036232890 8:7014190-7014212 AGGTAGAATGAAATGTTTGGTGG - Intronic
1037892198 8:22629317-22629339 AGGGAAGATGAAGTGATTCGGGG + Intronic
1037913221 8:22756720-22756742 AGGGAGAAGAAAGTGGTTGCTGG + Intronic
1037940026 8:22944314-22944336 AAGGAGCAGGATGTGATTGTTGG + Intronic
1038982266 8:32772925-32772947 AGGGAGAATGGAATCTTTGTGGG - Intergenic
1039130419 8:34257590-34257612 AGAGAGAATGAACTCACTGTAGG + Intergenic
1039383328 8:37106701-37106723 TGGGACAATGAAGTGTATGTTGG + Intergenic
1039392085 8:37189463-37189485 AGAGAGAATGGAGAGAGTGTGGG + Intergenic
1040650067 8:49437815-49437837 AAGCAAAATGAAGTGAATGTGGG + Intergenic
1042665196 8:71196425-71196447 AGGGTGAAGGAAGTCATTGTGGG + Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043819704 8:84847288-84847310 AGGCTGAGTGAAGTGACTGTGGG - Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045172659 8:99687634-99687656 CGGGAGAGAGTAGTGATTGTGGG - Intronic
1045310475 8:100997214-100997236 AGGAAGAAAGAAGAGTTTGTAGG - Intergenic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1045908831 8:107381409-107381431 AGTGAGCATGAAGTGGTTCTTGG - Intronic
1046215617 8:111141604-111141626 AGAGAGAGTGAAGTGATTATAGG - Intergenic
1046261928 8:111780009-111780031 AGGGAGCAAAAATTGATTGTTGG + Intergenic
1046504674 8:115122224-115122246 AGGGAGATTAAAGTGATTTGGGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1046907341 8:119587777-119587799 GGGGAGAAAGAGGAGATTGTAGG + Intronic
1047031985 8:120891906-120891928 AGGGAAAGTGAAATGGTTGTGGG - Intergenic
1047804266 8:128343020-128343042 CGGATGAATGAATTGATTGTTGG - Intergenic
1047996704 8:130343366-130343388 AGGGAAAAAGGAGTGAGTGTGGG - Intronic
1048883348 8:138888245-138888267 AGGGAGGATCAAGTGAGTGCTGG + Intronic
1050570962 9:6938588-6938610 AGGGAGAATGAAAAGAGTGCTGG - Intronic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051916440 9:22214112-22214134 AGAAAGAAATAAGTGATTGTTGG - Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052103925 9:24487941-24487963 AGGAAGAATGGAATAATTGTGGG + Intergenic
1052192585 9:25677346-25677368 AGGGAATATGAAGTGTTTCTTGG + Exonic
1053101731 9:35377068-35377090 TGGGATAATGAAGTACTTGTGGG - Intronic
1053618657 9:39794413-39794435 AGTGAGAATGAAGTGATGGCAGG - Intergenic
1053650585 9:40164747-40164769 ATGGAGAGTGAAGTCATTGGAGG - Intergenic
1053755153 9:41299177-41299199 ATGGAGAGTGAAGTCATTGGAGG + Intergenic
1053876834 9:42553775-42553797 AGTGAGAATGAAGTGATGGCCGG - Intergenic
1053895842 9:42740930-42740952 AGTGAGAATGAAGTGATGGCCGG + Intergenic
1054234863 9:62547947-62547969 AGTGAGAATGAAGTGATGGCCGG + Intergenic
1054265498 9:62913016-62913038 AGTGAGAATGAAGTGATGGCAGG + Intergenic
1054331095 9:63756518-63756540 ATGGAGAGTGAAGTCATTGGAGG - Intergenic
1054533998 9:66211455-66211477 ATGGAGAGTGAAGTCATTGGAGG + Intergenic
1054947159 9:70807795-70807817 ATGGAGGATGAGGTGAATGTGGG + Intronic
1054969179 9:71064735-71064757 AAGGAACATGAAGTCATTGTAGG - Intronic
1055181509 9:73393406-73393428 AGGGAGGCTGAAGTGACTGAAGG - Intergenic
1055693839 9:78861553-78861575 AGAGAGAATCAGGTGATTTTTGG - Intergenic
1055782586 9:79835350-79835372 AGTGAGATTTATGTGATTGTGGG + Intergenic
1055977051 9:81965779-81965801 AGGGAGCAAGATGTGACTGTTGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057084509 9:92196686-92196708 AAGGAAAGTGAAGTGAGTGTAGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058770251 9:108224053-108224075 GGAGACAATGCAGTGATTGTAGG - Intergenic
1059100518 9:111467139-111467161 AGGGAAAAATAAGTAATTGTAGG - Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1061086822 9:128404541-128404563 AGGGAGATGGAAGAGAGTGTTGG - Intergenic
1061427974 9:130512683-130512705 AGGGACAAAGAAGTGAATGAGGG - Intergenic
1062220075 9:135410290-135410312 AGGTACAATGAGGTGATTTTGGG + Intergenic
1202798469 9_KI270719v1_random:149438-149460 ATGGAGAGTGAAGTCATTGGAGG - Intergenic
1186110830 X:6254413-6254435 AGGAAGAATGAAGAGTTTTTAGG - Intergenic
1187120054 X:16396734-16396756 AGGGACAAGGAAATTATTGTTGG - Intergenic
1187549571 X:20288512-20288534 AAGGAAAATGGAGTGTTTGTGGG + Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188349209 X:29106291-29106313 AGGGAGAATGAAAGGTTGGTCGG - Intronic
1188550049 X:31353598-31353620 TGGGAGAATGAAGATATTGCTGG + Intronic
1188615197 X:32149838-32149860 AGGGAAAATGAAGTGAGATTGGG + Intronic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188773125 X:34179027-34179049 AGGGAGAGGGATGTGAGTGTGGG - Intergenic
1189044726 X:37578338-37578360 AGGGAGAAGGAAATGGTTGCTGG + Intronic
1189640650 X:43067449-43067471 AAGGAAAGTGTAGTGATTGTGGG + Intergenic
1189922811 X:45919836-45919858 AGGGAGAAAGAAGGGATTAGAGG - Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190337653 X:49271989-49272011 AGGGAGAATCTAGTGATCCTGGG - Intronic
1190966952 X:55309867-55309889 AGCCAGAATGAAGTGGATGTAGG - Intergenic
1191191914 X:57676946-57676968 AGGGATAATGAGTTGATTGCTGG - Intergenic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192069528 X:67922544-67922566 AGAGAGAGTGTAGTGGTTGTGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1192952352 X:76030005-76030027 AGGAAGAACGAAGAGATTCTTGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193440952 X:81538647-81538669 AGAGAAAATGAAGTGATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194269894 X:91799747-91799769 AGGGAGATTGAACTGATAGTAGG + Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194801357 X:98277531-98277553 AGGGAGAAGGATGGGATTGGGGG + Intergenic
1194921475 X:99771447-99771469 AGGGAGAAGGGAGTGAAGGTAGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195578575 X:106476896-106476918 AGGGAGAATGAATAGATCTTGGG + Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195765266 X:108289715-108289737 AGGGAGAGAGAAGTGAGTGCAGG - Intronic
1196181129 X:112690942-112690964 AAGGAGCATGAAGAGTTTGTCGG - Intergenic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196727217 X:118906913-118906935 ATGGAGTATGTAGTTATTGTGGG - Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197030595 X:121809192-121809214 AGGGACAGTGAAGTGAATGTGGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197657597 X:129133937-129133959 AGGGAGAAAGTACTGACTGTAGG + Intergenic
1198274123 X:135085525-135085547 AGGGAGAGTGTAGTTATAGTGGG - Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198873447 X:141199210-141199232 AGGGAGGAAGAGGTAATTGTTGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1199390928 X:147277887-147277909 AGGCAGAATGAGGTAATTTTGGG + Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1200587136 Y:5021166-5021188 AGGGAGATTGAACTGATAGTAGG + Intronic
1200587138 Y:5021186-5021208 AGGGAGATTGAACTGATAGTAGG + Intronic
1201517627 Y:14835272-14835294 AGGGAGGATGAAGGGACTGAAGG + Intronic
1202575877 Y:26324269-26324291 AGGTGGAATGAGGAGATTGTGGG + Intergenic