ID: 993140862

View in Genome Browser
Species Human (GRCh38)
Location 5:84031542-84031564
Sequence GGAGTCTTCATGAATGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993140862 Original CRISPR GGAGTCTTCATGAATGGAAC TGG Intronic
900608584 1:3534908-3534930 GGAGTCCAGATGAATGGAAGGGG - Intronic
901130257 1:6958111-6958133 GGAGTCTCCCTGAATGAAAATGG + Intronic
903161742 1:21493966-21493988 TGAGTCTTCAACAATGGAACTGG - Intergenic
906806224 1:48781264-48781286 GGAGTAGTCATGACTGGCACGGG + Intronic
910843959 1:91587614-91587636 GGAATCATCATGCATGAAACAGG - Intergenic
910867888 1:91804538-91804560 GAAGCCTTCCTGAATGGAGCTGG - Intronic
911164370 1:94711992-94712014 GGAGCCCTCATGGATGGGACTGG - Intergenic
911479774 1:98423401-98423423 GGGGTCTTCATTAAAGGAAGTGG + Intergenic
912310731 1:108618415-108618437 AGAGTGAGCATGAATGGAACAGG + Intronic
918248478 1:182681165-182681187 GGAGGCTGCATGGATGGGACAGG + Intronic
919173912 1:193994930-193994952 TGAGGCAACATGAATGGAACTGG + Intergenic
919428146 1:197459564-197459586 AGAGCCTTCATGAATGGGATTGG - Intronic
920060292 1:203222581-203222603 GGAGTTTTCTTGAGTGGAATAGG - Intronic
921688455 1:218118923-218118945 GGAGTCCTCATAAATGGAATTGG - Intergenic
922708485 1:227806828-227806850 GGCGTCTTCATTAATGGCATTGG + Intergenic
922811813 1:228420159-228420181 GGAGCCTTCATGAATAGGATTGG + Intergenic
923091663 1:230745652-230745674 GGAGCCCTCATGAATGGGATTGG - Intergenic
923877045 1:238060484-238060506 GGTGCCTGAATGAATGGAACAGG + Intergenic
1063600637 10:7477632-7477654 GGAGCCCTCATGAATGGGATTGG + Intergenic
1064218089 10:13417252-13417274 GGAGTCTTCGTGAATGGAATTGG + Intergenic
1064488544 10:15823944-15823966 GCAGTATACGTGAATGGAACTGG - Intronic
1065721655 10:28633771-28633793 GGATTCCTCATGAATGGCTCGGG - Intergenic
1068397564 10:56484158-56484180 CCAGTCTTCATGAATGGATGAGG - Intergenic
1069698598 10:70405508-70405530 GGAGCCTTATTGAAGGGAACGGG + Intronic
1069706238 10:70460416-70460438 TCAGTCTTGATGAATGGAGCCGG - Intergenic
1069722369 10:70557835-70557857 GGAGTCTTCAGTAATGGCAGGGG + Intronic
1070487167 10:76942280-76942302 GGAGCCCTCATGAATGGGACTGG - Intronic
1070725237 10:78783176-78783198 ATAGTCCTCATGAAGGGAACTGG + Intergenic
1071265737 10:83963215-83963237 GGAGCCCTCATGAATGGGATTGG + Intergenic
1073208717 10:101782025-101782047 GGAGTCTTCATTATTGGAGCTGG + Intronic
1073427202 10:103462532-103462554 GGAGCCCTCGTGAATGGAATTGG + Intergenic
1075951753 10:126484196-126484218 GGCGTATTCATGAAGAGAACTGG - Intronic
1077278479 11:1729741-1729763 GAACTTTTTATGAATGGAACCGG - Intergenic
1077956625 11:7027460-7027482 AGAGCCTTCATGAATGGAATTGG - Intronic
1078639664 11:13082934-13082956 GGAGACTCCATGCATGGAGCTGG + Intergenic
1083041810 11:59695409-59695431 CGCGTCTTAATGAATGGAGCTGG + Intergenic
1083103210 11:60331814-60331836 GGAGTCCTCATGAATGGGATTGG + Intergenic
1085196083 11:74672710-74672732 GGTGCCTTTGTGAATGGAACTGG - Intergenic
1085431392 11:76452629-76452651 TGAGTATTTATGAATGGAATGGG + Intronic
1086854251 11:91847454-91847476 GGAGTCTTGATAAATGGCAAGGG + Intergenic
1088374346 11:109123802-109123824 GGAGGCTTCTTGAAAGGAATAGG + Intergenic
1091114265 11:132998713-132998735 GGAGCCCTCATGAATGGGATAGG + Intronic
1092522395 12:9288261-9288283 GAAGTCTTCCTGGATGGAATAGG - Intergenic
1092544888 12:9443601-9443623 GAAGTCTTCCTGGATGGAATAGG + Intergenic
1092695689 12:11169202-11169224 AGAGTATTCATGATTGGAAATGG - Intronic
1094508062 12:31078449-31078471 GAAGTCTTCCTGGATGGAATAGG - Exonic
1095453841 12:42361145-42361167 GGATTCCTCATGAATGGGATTGG + Intronic
1098976943 12:76912676-76912698 GGAGACTTAAGAAATGGAACTGG - Intergenic
1100270349 12:93018746-93018768 TGTATCTTCATCAATGGAACCGG + Intergenic
1100884533 12:99055405-99055427 GGAGTCTTGATGACTGGATTTGG + Intronic
1101402763 12:104402732-104402754 GGAGCCCTCATGAATAGAATTGG - Intergenic
1101404310 12:104414503-104414525 GGAGCCCTCATGAATGGAATTGG + Intergenic
1106410471 13:29507844-29507866 AAAGTCTTCAGGAATGAAACAGG - Intergenic
1106592433 13:31109428-31109450 GGAGTCTTGAAAGATGGAACAGG - Intergenic
1108893706 13:55295538-55295560 GTATCCTTCATGAATGGCACGGG + Intergenic
1109421932 13:62124758-62124780 GGAGAGTTGATAAATGGAACTGG - Intergenic
1110740931 13:78995662-78995684 GGAGTCTTCTGTAGTGGAACTGG + Intergenic
1112669277 13:101615601-101615623 GGAGTCCTCATGAAAGGGAATGG + Intronic
1114537563 14:23432601-23432623 AGGGTCTTCCTGAAGGGAACTGG - Intronic
1116118214 14:40685162-40685184 GGAGGTTTCATGCATGGAAGTGG + Intergenic
1117282268 14:54252821-54252843 TGAGTCTTCATAAGTGGACCTGG - Intergenic
1118504322 14:66393764-66393786 GGAGGCCTCAGGACTGGAACAGG - Intergenic
1118813093 14:69289637-69289659 GGAGTCTTCCTGGAAGGAAACGG + Intronic
1120549308 14:85849826-85849848 GTATTTTTCATGAATGGCACAGG + Intergenic
1120934416 14:89880201-89880223 AGAGCCTTCATGAATGGGATTGG + Intronic
1120947958 14:90015734-90015756 GGGGTCCTCATGAATGAGACTGG - Intronic
1121236296 14:92393520-92393542 TGTGTCTTCTTGGATGGAACTGG - Intronic
1121814002 14:96915210-96915232 GGAGTCCTCATGGCTGGAGCAGG - Intronic
1123150297 14:106175024-106175046 CGAGTGTTCATAAATGGAGCAGG - Intergenic
1127372926 15:58357138-58357160 GGAGTATTCATCAAAGGAAAAGG + Intronic
1127543305 15:59965034-59965056 AAAGTCTACATCAATGGAACAGG + Intergenic
1130558988 15:84944232-84944254 TGAGTCTTCATGAAGTGAAGTGG + Intronic
1131060803 15:89403460-89403482 GGATTCCTCATGAGTGGGACTGG + Intergenic
1131432461 15:92397587-92397609 GGAGTGTGCATGAATTGATCAGG - Intronic
1136028127 16:27483063-27483085 GGAGATTTCATGAATCGAAGAGG - Exonic
1136679074 16:31944499-31944521 GGAGTCTTCATTATTGAAAGTGG - Intergenic
1137432453 16:48429191-48429213 TGAATTTTCATAAATGGAACTGG - Intronic
1140675206 16:77321422-77321444 AGACTCTTCATCAATGAAACTGG + Intronic
1143094913 17:4473687-4473709 GGAGTCTTCAAGACTGGGAAGGG - Intronic
1143551932 17:7635622-7635644 GGAGTCTTCAGCAATGGAGAGGG + Intergenic
1147984329 17:44296285-44296307 GGATTCTTCCTGAAGGGAACTGG + Intergenic
1149144363 17:53472240-53472262 GGAGACTTCATGAATGGGATGGG - Intergenic
1149154435 17:53609625-53609647 ATAATCTTCATGAATGCAACTGG + Intergenic
1149214870 17:54342399-54342421 GGAGGCTTCGTAAATGGAATTGG + Intergenic
1150345663 17:64402923-64402945 GGAGGCCTCATGAATGGGACTGG + Intronic
1151603881 17:75124302-75124324 GGAGTCTCCAAGGATGGACCGGG - Intronic
1157525048 18:48374342-48374364 GAACTCTTCATGAAAGGAAGAGG + Intronic
1158090977 18:53713260-53713282 AGAGCCTTCATGAATGGGATTGG + Intergenic
1158777441 18:60601841-60601863 GGAGTATTCAAGAATGGTAGTGG - Intergenic
1159395688 18:67853092-67853114 GGAGCCAACATGAATGGAGCTGG - Intergenic
1164847350 19:31444961-31444983 GGAGGCTGCAAGAATGGAAGAGG + Intergenic
925333919 2:3079143-3079165 GTAGACTTTATGAATGGAAAGGG - Intergenic
926160839 2:10488123-10488145 GAAGCCTCCATGAATGGAAGTGG - Intergenic
926160902 2:10488413-10488435 GAAGCCTCCATGAATGGAAGTGG - Intergenic
926994176 2:18715866-18715888 GGAGTCACCATGAAAGGAAGAGG - Intergenic
927982127 2:27380711-27380733 GGGGGCTCCATGAATGGAAGCGG - Exonic
933436859 2:82260124-82260146 GGAGTCTGAAGGAATAGAACAGG + Intergenic
934780500 2:96966750-96966772 GGAGCCTTCATGAATAGGATTGG + Intronic
936635058 2:114246646-114246668 GGAGCATTCATGAATGGAATTGG + Intergenic
937174605 2:119916662-119916684 GGAGGCTTAATGACTGGAAGTGG - Intronic
938201804 2:129378226-129378248 GGAGGCTTCAGGAATGGTAGAGG + Intergenic
938829869 2:135039690-135039712 GGAGGCTTCATGAATAGAAAGGG - Intronic
940131686 2:150389027-150389049 AGAGCCTTCATGAATGGGATTGG + Intergenic
940188399 2:151011874-151011896 AGAGCCTTTATGAATGGAATTGG - Intronic
940622689 2:156132321-156132343 GGAATCTTCTTGAATTGAAGTGG - Intergenic
941823603 2:169867770-169867792 TGAGTCTGCATGATTGGCACTGG - Intronic
942597041 2:177601291-177601313 GGAGTTTTCCTGAAAGGAATGGG - Intergenic
943196228 2:184753778-184753800 GGAGCCTTCATGAAGGAAATAGG + Intronic
946650637 2:221889808-221889830 GGAATCTTCAAGAATGTAAGTGG - Intergenic
946971303 2:225094831-225094853 TGAGACAACATGAATGGAACTGG + Intergenic
947351981 2:229255861-229255883 GGAGTTTTCATGATTGGAGTGGG - Intronic
947421329 2:229943719-229943741 GGAGTTTTGAGGAATGGATCTGG - Intronic
1170108533 20:12779302-12779324 GGAGTCTTTATTAGTGGAAGAGG - Intergenic
1170800555 20:19586586-19586608 CGAGTCTACATCAGTGGAACGGG - Intronic
1171024045 20:21612582-21612604 GGAATCTTCATGTACAGAACTGG + Intergenic
1171039338 20:21745327-21745349 GGAGACTGCAGGAATGGAAGTGG + Intergenic
1171924659 20:31179188-31179210 GGAGTGTACAAGAATGGAATGGG + Intergenic
1172184646 20:33023743-33023765 GGAGACTGCATGTAGGGAACTGG - Intergenic
1173881285 20:46414410-46414432 GGAACCTTCATGAATGGGATTGG - Intronic
1174696345 20:52563355-52563377 TGAGGCAACATGAATGGAACTGG - Intergenic
1178566558 21:33691817-33691839 GGAGCCTTCATGAATGGGATTGG - Intronic
1179500192 21:41803743-41803765 GCAGTCTTCATGAAGGGCACTGG - Intronic
1184171265 22:42761154-42761176 TGCCTCATCATGAATGGAACAGG + Intergenic
1184905516 22:47483083-47483105 GGAGGCTTCATGAATGGGATTGG + Intronic
950155617 3:10719450-10719472 GGAGCCCTCATGAATGGGATTGG - Intergenic
951281294 3:20753047-20753069 GGAGTCTTCTTGGATGGAAAGGG - Intergenic
953075473 3:39565939-39565961 GGAATTTTCATTAATGTAACTGG - Intergenic
954718181 3:52537451-52537473 GAAGTCCTCCTGAAAGGAACTGG - Intronic
955013094 3:55039005-55039027 GGAGTCATCAGCCATGGAACCGG + Intronic
958163212 3:89845244-89845266 TGAGAGTTCATGAATGGGACTGG + Intergenic
958712765 3:97738293-97738315 TGAGTCTGCATTAATGGAAGAGG + Intronic
958805703 3:98807367-98807389 AGAGTCCTCATGAATGGGATTGG + Intronic
959569308 3:107866340-107866362 GGAGCCCTCATGAATGGGATTGG + Intergenic
959623850 3:108427356-108427378 GGAGCCTTCATCAATGGGACTGG + Intronic
960029730 3:113045097-113045119 AGAGCCCTCATGAATGGAATTGG + Intergenic
960479740 3:118173002-118173024 GGAGCTCTCATGAATGGAATTGG + Intergenic
961736007 3:129002529-129002551 GGGGTTTTCAGGAATGGAATAGG - Intronic
965324460 3:167285878-167285900 GGTATCTTCAGTAATGGAACAGG - Intronic
967087341 3:186107871-186107893 GGAGTTTTCATGAATGGGGAAGG - Intronic
967322565 3:188209133-188209155 GGAGTCTACAGAATTGGAACTGG + Intronic
970104113 4:12560895-12560917 AGAGTCTTCATGAATGGCTTGGG - Intergenic
971443482 4:26716281-26716303 GAAGTCATCCAGAATGGAACAGG + Intronic
971771617 4:30904566-30904588 CAAGTCTTAATGAATGGAAGCGG - Intronic
972426448 4:38937668-38937690 GGAGGCTTTATGAAAGGCACTGG + Intronic
974065967 4:57077694-57077716 TCAGTCTTCAGGAATGTAACAGG + Intronic
975184186 4:71382002-71382024 GGAGTGTTGATTAAAGGAACTGG + Intronic
975280664 4:72558452-72558474 GGAGTCTTTATAAATGGAAGAGG - Intronic
976059205 4:81106782-81106804 GAAGCCCTCATGAATGGGACTGG + Intronic
979340987 4:119523835-119523857 GGAGTACTCAGGAATGGAAAAGG + Intronic
979543756 4:121916538-121916560 GGAGCCTTCATGAATGAGACTGG + Intronic
979920726 4:126492656-126492678 GGATCCCTCATGAATGGATCGGG + Intergenic
980502709 4:133677199-133677221 GGAGCCGTCATGAATGGGATTGG - Intergenic
980679517 4:136139280-136139302 AGAGTCCTCATGAATGGAATTGG - Intergenic
983442922 4:167810293-167810315 GGAGTTTTCATTAATGTAAGGGG - Intergenic
983491642 4:168397011-168397033 AGAGTTTTCATGAATGGGATTGG + Intronic
983910336 4:173232024-173232046 TGAGTCTTTATAAATGGAATTGG + Intronic
983931343 4:173456043-173456065 GCACTTTTCAAGAATGGAACAGG + Intergenic
988969262 5:36449642-36449664 GCTGGCTTCATGAATGGGACAGG + Intergenic
990252271 5:53928122-53928144 GGAGTCTTCATGGAGGAGACAGG + Intronic
992040421 5:72825363-72825385 GGAGTCCTCATGAATAGGATTGG + Intronic
993140862 5:84031542-84031564 GGAGTCTTCATGAATGGAACTGG + Intronic
994111624 5:96011555-96011577 GGAGAATACATTAATGGAACAGG - Intergenic
994549345 5:101210674-101210696 AGAGTCTCCATGGATGGAAGAGG - Intergenic
995835065 5:116392494-116392516 GGTGTCCTCATGAATGGGATTGG - Intronic
996893262 5:128448229-128448251 GGAGTCTTCATGAACAGTAGAGG - Intronic
997828399 5:137128084-137128106 GGAGACCTCATGAATGGAATTGG + Intronic
1001871174 5:175157243-175157265 GGAGCCCTCATCAATGGGACTGG + Intergenic
1003251386 6:4431851-4431873 GGAGTCCTCATGAATGGGATTGG - Intergenic
1003516559 6:6823392-6823414 GGAGTCTTGCTGTGTGGAACAGG - Intergenic
1003735955 6:8877895-8877917 GGAGCCCTCATGAATGGGATTGG - Intergenic
1003903176 6:10674185-10674207 AGAGCCCTCATGAATGGAAATGG - Intronic
1005588493 6:27300494-27300516 GGAGACTTCAGGACTGGGACAGG - Intronic
1007875798 6:45099170-45099192 GGAGTTGTCATGAAAGGAAAGGG - Intronic
1009563376 6:65277107-65277129 GGAGTCCTCACGAATGGGATTGG + Intronic
1011098509 6:83694661-83694683 AAAGTCTTCAAGAATGGAATAGG + Intronic
1011221308 6:85057158-85057180 GGAACCCTCATGAATGGAATTGG - Intergenic
1011441380 6:87390976-87390998 TGAGCCTTCATGAATGGGATTGG - Intronic
1012297948 6:97547894-97547916 GGAGTCTTCATGATTGGAATTGG - Intergenic
1012465277 6:99510558-99510580 GGAGCCCTCATGAATGAGACTGG + Intronic
1012926634 6:105274333-105274355 GGAATCCTCATGAATGGGACTGG - Intergenic
1013748465 6:113373419-113373441 GAAGAGTTCAGGAATGGAACTGG + Intergenic
1014646150 6:123975738-123975760 GGAGCCCTCATGAATGGGATTGG - Intronic
1018503038 6:164433299-164433321 AGAGCCTTCATAAATGGAACTGG - Intergenic
1018634738 6:165850709-165850731 GGAGTCTTTATGAAAAGAGCTGG - Intronic
1018645674 6:165945543-165945565 GTAGCCTTCATGAATGGGATTGG + Intronic
1018763696 6:166912493-166912515 TGAGTCCTGATGAATGAAACTGG - Intronic
1021509984 7:21425168-21425190 GGAGTCCTCATGAATGAGATTGG - Intergenic
1022475065 7:30704685-30704707 GAAGTGTTCAGGAATTGAACAGG + Intronic
1022981056 7:35605379-35605401 GGAGCCCTCACGAATGGAATGGG + Intergenic
1023384992 7:39647674-39647696 AGAGACCTCATGAATGGAATTGG + Intronic
1024794193 7:53003210-53003232 GGAGTCTTCAGAAATGGAGGAGG + Intergenic
1024918641 7:54533067-54533089 GGACACCTCATGAATGGAATTGG + Intergenic
1024930915 7:54665742-54665764 GGAGCCCTCATGAATGGGATTGG + Intergenic
1026614506 7:71889497-71889519 GGAGTCCTCATGAATGAGACTGG - Intronic
1030196444 7:106858096-106858118 GGAGTCTGCAAGAATGTAGCAGG + Intergenic
1032553404 7:132806550-132806572 AGGGTCTTCAAGAATGGAAAGGG + Intronic
1032587921 7:133164637-133164659 GGATTCTTGATGACTGGAGCTGG + Intergenic
1035000689 7:155610214-155610236 GGAGCCATCGTGAATGGGACTGG - Intergenic
1039155765 8:34554766-34554788 GGAGACCTCCTGAATGGGACTGG + Intergenic
1039307187 8:36275316-36275338 GGAGCCCTCATGAATGGGATTGG - Intergenic
1040809046 8:51430020-51430042 GGAGACTTCTTGATTGGATCAGG - Intronic
1040813131 8:51479560-51479582 AGAGTCATCATGGATGGAACTGG + Intronic
1041807873 8:61873557-61873579 GGAACCTTCATGAATGGGATTGG + Intergenic
1044920462 8:97164646-97164668 TGAGGCTTCAGGAATTGAACTGG + Intergenic
1047597131 8:126389803-126389825 GGTGTATTCATTAGTGGAACAGG + Intergenic
1048128950 8:131670523-131670545 TGCATCATCATGAATGGAACTGG - Intergenic
1049855371 8:144858450-144858472 ACAGTCTTCATCACTGGAACTGG - Intergenic
1057789508 9:98114806-98114828 GCAGTCTTCATGAATGCCTCAGG - Intronic
1057974385 9:99588821-99588843 GGAGTCCTCATGAATGAGATAGG + Intergenic
1058983170 9:110188772-110188794 GGAGACCTCATGAATGGTACTGG + Intergenic
1059535217 9:115074328-115074350 GGAGGCCTCATGAATGGGAGTGG + Intronic
1059658920 9:116382211-116382233 AGAGTCTTTATGAATGGTAGAGG + Intronic
1059729366 9:117041692-117041714 GGAGTCTTCATGAAAGGCCTTGG - Intronic
1060772306 9:126341275-126341297 GTAGTCCTGATGATTGGAACTGG + Intronic
1060830038 9:126708003-126708025 GGTGTCTTCATCTATGGAATAGG - Intergenic
1185890970 X:3821779-3821801 GGAGGCCTGATGGATGGAACTGG - Intronic
1185896081 X:3860192-3860214 GGAGGCCTGATGGATGGAACTGG - Intergenic
1185901200 X:3898618-3898640 GGAGGCCTGATGGATGGAACTGG - Intergenic
1185906314 X:3937056-3937078 GGAGGCCTGATGGATGGAACTGG - Intergenic
1189083802 X:37999564-37999586 GGAGTCTTCATGACAAGAAAGGG + Intronic
1190241068 X:48658627-48658649 GGAGCCCTCATGAATGGGATTGG - Intergenic
1190756783 X:53408364-53408386 GGAGGCTGCAGGAAGGGAACTGG - Intronic
1194083915 X:89502557-89502579 GGAGCCTTCATGCATGGGATTGG + Intergenic
1195013045 X:100752120-100752142 GCATCCTTCAAGAATGGAACAGG + Intergenic
1195239870 X:102940371-102940393 GGAGTCTTTTTGAATGACACAGG + Intergenic
1196731549 X:118946025-118946047 AGAGTCCTCTTGAATGGAATTGG + Intergenic
1200071818 X:153532994-153533016 ACTGTCTTCATGAATGCAACAGG - Intronic
1200436562 Y:3158437-3158459 GGAGCCTTCATGCATGGGATTGG + Intergenic