ID: 993142206

View in Genome Browser
Species Human (GRCh38)
Location 5:84049341-84049363
Sequence TCTGGTGGATTGTGTACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993142206_993142208 -10 Left 993142206 5:84049341-84049363 CCTGAGGTACACAATCCACCAGA 0: 1
1: 0
2: 0
3: 5
4: 93
Right 993142208 5:84049354-84049376 ATCCACCAGAAAGGAAAAGAAGG 0: 1
1: 1
2: 1
3: 46
4: 483
993142206_993142209 -9 Left 993142206 5:84049341-84049363 CCTGAGGTACACAATCCACCAGA 0: 1
1: 0
2: 0
3: 5
4: 93
Right 993142209 5:84049355-84049377 TCCACCAGAAAGGAAAAGAAGGG 0: 1
1: 1
2: 4
3: 89
4: 905

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993142206 Original CRISPR TCTGGTGGATTGTGTACCTC AGG (reversed) Intronic
900131529 1:1089295-1089317 TGTGAGGGATTGTGTACCCCAGG - Intronic
901872120 1:12144335-12144357 TCTGGTAGATTGGATACTTCTGG + Intergenic
908003294 1:59702869-59702891 TCTGGAGGATTGAGTGCCCCAGG - Intronic
908050326 1:60222609-60222631 ACTAGGGGATTCTGTACCTCTGG - Intergenic
910373400 1:86542882-86542904 TCTGCTGGAATGTCTACCTGAGG + Intergenic
918975767 1:191483913-191483935 GCTGAGGGAATGTGTACCTCAGG - Intergenic
1065819112 10:29509065-29509087 TCTGGTGGAATGAGTTACTCTGG + Intronic
1066048803 10:31617413-31617435 TCTGGTGGACAGAGGACCTCAGG - Intergenic
1067179934 10:43977483-43977505 GCTGGTGGATTGAGAACATCTGG + Intergenic
1067894933 10:50168786-50168808 TCTTCTGGATTATATACCTCAGG - Intergenic
1067953903 10:50771476-50771498 TCTTCTGGATTATATACCTCAGG + Intronic
1077035149 11:490911-490933 TCTGGGGCAGTGTGTCCCTCAGG + Exonic
1081952969 11:47061710-47061732 TCTTGTTGATTGTCTACATCTGG - Intronic
1083825681 11:65202190-65202212 CCTGTTGGATTCTCTACCTCAGG + Intronic
1084640855 11:70424764-70424786 TCTGGTGGCTTCTGAGCCTCAGG + Intronic
1085536976 11:77227680-77227702 TCTGGAGGACTCTGTACATCAGG - Intronic
1087649887 11:100852829-100852851 TCTGCTGAACTTTGTACCTCTGG - Intronic
1088340732 11:108763167-108763189 TCTGGTGCATTTTCTTCCTCTGG + Intronic
1095925808 12:47578071-47578093 TCTGGTGCATTCTGTCCCTCAGG - Intergenic
1096788585 12:54031633-54031655 TCTGGCGGATTTTTTCCCTCCGG - Intronic
1096815152 12:54197248-54197270 TCTGCTGGAATGTGTCTCTCAGG + Intergenic
1100610641 12:96189521-96189543 TCTGGTGGAATGTGTACATTTGG - Intergenic
1101291137 12:103370824-103370846 TATGGTGAACTGTGTACCACAGG - Intronic
1104128570 12:125871233-125871255 TCTGATGCATTCTGGACCTCTGG + Intergenic
1106974096 13:35185569-35185591 TCTGGTGGAGTGTGTTCCAAAGG + Intronic
1122054019 14:99080114-99080136 TCTGGTGGGTTCTGTCCATCAGG - Intergenic
1124590806 15:31051346-31051368 CCTGGTGGATTGCCTACCTGAGG + Intronic
1130771316 15:86926751-86926773 TCTGGAGGATTGGATACCACAGG + Intronic
1138302793 16:55946615-55946637 TCTGGAAGAGTGTGTACCTTGGG + Intronic
1138969599 16:62128898-62128920 TCTGGTGTCTTCTCTACCTCTGG - Intergenic
1143023227 17:3927381-3927403 TCAGGTGGCTTGTCTTCCTCGGG - Intronic
1152033170 17:77856131-77856153 TCTGGTGGCTTCTGTCCCACTGG - Intergenic
1157586489 18:48804554-48804576 TTTGGTGGATGGAGTAACTCAGG + Intronic
1157814189 18:50719230-50719252 TCTGGTGGATTTTGTGCTTTGGG + Intronic
1158901250 18:61963802-61963824 TCTGTTGCATTGGGTGCCTCTGG - Intergenic
1160400125 18:78604115-78604137 TCCGGGAGATTGTGTACATCTGG - Intergenic
1164759119 19:30715044-30715066 TCTGGTGTCTTGTGTGGCTCTGG - Intergenic
925064209 2:916634-916656 ACTGGGTGATTGTGAACCTCGGG + Intergenic
928686764 2:33758206-33758228 TCTGTTGGATTATGTATTTCAGG - Intergenic
930323236 2:49881980-49882002 TGAGATGGATTGGGTACCTCAGG - Intergenic
932581210 2:72993787-72993809 TGTGGTGGAGGGTGTACCTCAGG - Intronic
933098547 2:78220626-78220648 GCTGGTGGATTTTGTATATCGGG - Intergenic
936380744 2:111983657-111983679 CTTGGTGGATTGTGCACCTGAGG + Intronic
937534057 2:122864371-122864393 TCTGGTGGTTTGTGTTTCTTTGG + Intergenic
937867746 2:126766723-126766745 TCGGGTGGATTGGGCATCTCTGG - Intergenic
940153356 2:150627294-150627316 GCTGGTGGCATTTGTACCTCTGG + Intergenic
942359642 2:175158363-175158385 TGTGGTGGCATGTGTACCTGTGG - Intronic
942996369 2:182265566-182265588 TCTCGTGGTTTCTGTAACTCAGG - Intronic
946482722 2:220072648-220072670 TCTGGTGGATTTGGTGCCCCTGG + Intergenic
1169228514 20:3871246-3871268 TCTGGAGGATTTTGTGCCTAAGG + Exonic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1174455511 20:50645881-50645903 TCTTGTAAATTGTTTACCTCTGG - Intronic
1182551719 22:31104319-31104341 GCTGGTGGACTGTGTGCCCCTGG + Exonic
1182884708 22:33763497-33763519 ACTGGTGGAATGTGTACGTAGGG - Intronic
1185164936 22:49255589-49255611 GCAGGTGGATTTTGGACCTCAGG + Intergenic
957415430 3:79896250-79896272 TCTAGGGGATTTTATACCTCAGG + Intergenic
963466720 3:145691060-145691082 TATGGTGGATTGGGTATCTGGGG + Intergenic
971999727 4:34015310-34015332 TCAGGTGGAATGAGTAGCTCAGG + Intergenic
979404027 4:120286920-120286942 TCTGGTGGAATGGGTAGCTGTGG + Intergenic
980688597 4:136261535-136261557 TTTGTTGGATGGTGTAACTCAGG - Intergenic
985843054 5:2323968-2323990 TATGGTGCACTGTGTACCACGGG + Intergenic
985970487 5:3374245-3374267 TCAGGTAGATTGTGAAACTCTGG - Intergenic
987881060 5:23746888-23746910 TCTTGGAGATTGAGTACCTCAGG - Intergenic
988408168 5:30851015-30851037 TTTGGTGGATTGTCTCCCTAGGG - Intergenic
993142206 5:84049341-84049363 TCTGGTGGATTGTGTACCTCAGG - Intronic
993510816 5:88769525-88769547 TCTGCTGGATTGAGGATCTCAGG - Intronic
999371832 5:151060343-151060365 TCTGGTGAATTCTGCTCCTCAGG + Exonic
1001281944 5:170392317-170392339 TCTCGTGGATTTTGTGGCTCTGG - Intronic
1001377424 5:171275083-171275105 TCTGCTGGTTTGGGTACATCTGG - Intronic
1001732918 5:173973422-173973444 TCTGGTCGACTGTCTCCCTCCGG + Intergenic
1007325914 6:41059442-41059464 TCTGGTGGGGTGAGTACCTTTGG + Intronic
1008859332 6:56130051-56130073 TGTGGTGGAATGTGTTCTTCAGG + Intronic
1014965556 6:127743742-127743764 TATGATGCATTGTGTACCTCAGG - Intronic
1022095032 7:27134364-27134386 TCTGGAGGATTTTGAACCTCAGG - Intronic
1022545102 7:31179962-31179984 TCTGGTGGTATGGGCACCTCTGG - Intergenic
1023612256 7:41982820-41982842 TCTGATGAGTTGTGTACCTTTGG + Intronic
1026152045 7:67796183-67796205 GCTGGTGGTCTGTGTACTTCTGG + Intergenic
1026565078 7:71483072-71483094 CCTGGGGGATTGGGGACCTCTGG + Intronic
1027165366 7:75830275-75830297 TCTGGGGGACTGTGTTCCTAAGG - Intergenic
1031659978 7:124411500-124411522 TCTGGTGGAGTTGGTTCCTCAGG - Intergenic
1035988247 8:4458053-4458075 CATGAAGGATTGTGTACCTCAGG - Intronic
1039160996 8:34619771-34619793 CTTGGTGGAATGTGTACCTGTGG + Intergenic
1039839000 8:41280227-41280249 ACTGGATGATTGTGTGCCTCGGG - Intronic
1041865601 8:62570150-62570172 TCTTGTGGAGTGAGTACCCCTGG - Intronic
1044096484 8:88072525-88072547 TCTGGTACATTGTCAACCTCAGG - Intronic
1047695407 8:127398630-127398652 TCAGGTGGATTGTCCACATCTGG + Intergenic
1049315795 8:141966707-141966729 TCGTGTGGATTGTGAGCCTCAGG - Intergenic
1049471826 8:142778257-142778279 CATGGTGTATTCTGTACCTCAGG - Intergenic
1051901017 9:22040431-22040453 TCTGGTTGTTTGTGAACATCTGG - Intergenic
1053334693 9:37256296-37256318 TCGTGTGGTCTGTGTACCTCTGG + Intronic
1057846285 9:98527881-98527903 TATGCTGGAATGGGTACCTCAGG - Intronic
1058124913 9:101180245-101180267 TCTGATTGATTATGTCCCTCTGG + Intronic
1060665693 9:125430925-125430947 GCTGGTGGGGTGTGTGCCTCAGG + Intergenic
1203703452 Un_KI270742v1:14618-14640 TCTTGTTGGTTCTGTACCTCTGG + Intergenic
1189443193 X:41056095-41056117 TATGGTGGATTCTGTACTGCAGG - Intergenic
1189733449 X:44045834-44045856 TTGGGTGGAGTGTGTAGCTCAGG - Intergenic
1192499686 X:71641846-71641868 TTTGGTGGACTGTGTATTTCTGG + Intergenic
1196611085 X:117715601-117715623 TCTTGTGGAATCTGTAGCTCTGG + Intergenic
1200079131 X:153566884-153566906 TCTGGGGGACTCTGTAGCTCTGG - Intronic