ID: 993142206

View in Genome Browser
Species Human (GRCh38)
Location 5:84049341-84049363
Sequence TCTGGTGGATTGTGTACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993142206_993142209 -9 Left 993142206 5:84049341-84049363 CCTGAGGTACACAATCCACCAGA 0: 1
1: 0
2: 0
3: 5
4: 93
Right 993142209 5:84049355-84049377 TCCACCAGAAAGGAAAAGAAGGG 0: 1
1: 1
2: 4
3: 89
4: 905
993142206_993142208 -10 Left 993142206 5:84049341-84049363 CCTGAGGTACACAATCCACCAGA 0: 1
1: 0
2: 0
3: 5
4: 93
Right 993142208 5:84049354-84049376 ATCCACCAGAAAGGAAAAGAAGG 0: 1
1: 1
2: 1
3: 46
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993142206 Original CRISPR TCTGGTGGATTGTGTACCTC AGG (reversed) Intronic