ID: 993143215

View in Genome Browser
Species Human (GRCh38)
Location 5:84060405-84060427
Sequence GAGCGTTCTGAAGATGCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 168}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993143208_993143215 20 Left 993143208 5:84060362-84060384 CCAGCCGAGCTTTCCTTGGTTCC 0: 1
1: 0
2: 0
3: 4
4: 105
Right 993143215 5:84060405-84060427 GAGCGTTCTGAAGATGCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 168
993143209_993143215 16 Left 993143209 5:84060366-84060388 CCGAGCTTTCCTTGGTTCCCAAG 0: 1
1: 0
2: 2
3: 26
4: 224
Right 993143215 5:84060405-84060427 GAGCGTTCTGAAGATGCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 168
993143212_993143215 -2 Left 993143212 5:84060384-84060406 CCAAGTGAACATGTCCATGTTGA 0: 1
1: 0
2: 1
3: 9
4: 137
Right 993143215 5:84060405-84060427 GAGCGTTCTGAAGATGCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 168
993143211_993143215 -1 Left 993143211 5:84060383-84060405 CCCAAGTGAACATGTCCATGTTG 0: 1
1: 0
2: 1
3: 8
4: 134
Right 993143215 5:84060405-84060427 GAGCGTTCTGAAGATGCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 168
993143210_993143215 7 Left 993143210 5:84060375-84060397 CCTTGGTTCCCAAGTGAACATGT 0: 1
1: 0
2: 0
3: 15
4: 138
Right 993143215 5:84060405-84060427 GAGCGTTCTGAAGATGCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 168
993143206_993143215 30 Left 993143206 5:84060352-84060374 CCTTGCTTGTCCAGCCGAGCTTT 0: 1
1: 0
2: 1
3: 8
4: 81
Right 993143215 5:84060405-84060427 GAGCGTTCTGAAGATGCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993143215 Original CRISPR GAGCGTTCTGAAGATGCTGG AGG Exonic
903687721 1:25144333-25144355 GATCGTTCAGATGTTGCTGGTGG + Intergenic
905387056 1:37612356-37612378 GAGCCTTCTGGAGAAGCTGCTGG - Exonic
905580526 1:39080821-39080843 GAGCGTCCTGCAGATCCTGCGGG - Intergenic
908385972 1:63642216-63642238 GATTGTTCTGCAGATGCTAGTGG - Intronic
910978074 1:92929330-92929352 GAGCTTTCAGCAGATGCTGATGG - Intronic
919214451 1:194534513-194534535 GAGCTTGCTGAAGCTGCTGTGGG + Intergenic
920764942 1:208823358-208823380 GTGCATCCTGAAGATGATGGAGG + Intergenic
921556598 1:216605890-216605912 GACCCTTCTGAAGAAGCTGTTGG + Intronic
921762872 1:218937288-218937310 GAGCTTGCTGCAGATGCTGTGGG + Intergenic
922927708 1:229364275-229364297 TTGCCTTCTGTAGATGCTGGTGG - Intergenic
924112183 1:240711205-240711227 GAGGGGTCAGAGGATGCTGGAGG - Intergenic
924867150 1:247996053-247996075 CAGCCTTCTGGAGATGCTTGGGG - Intronic
1064526134 10:16258855-16258877 TGGCTTTCTGAAAATGCTGGTGG + Intergenic
1065045296 10:21742677-21742699 GTGAGTTCTGAGGCTGCTGGGGG + Exonic
1070127801 10:73635930-73635952 GAGCCTCCTGAAGAAGTTGGTGG - Intronic
1072399807 10:95086481-95086503 GAGCCATCTGAAGCTGCAGGTGG + Intergenic
1072611415 10:97019686-97019708 GTGCATCCTGGAGATGCTGGAGG - Intronic
1072627544 10:97122932-97122954 GAGGGGCCTGGAGATGCTGGAGG - Intronic
1073553864 10:104428921-104428943 GACAGTTCTGAAGAGGCTGCTGG + Intronic
1074919462 10:117992901-117992923 GAGGGTTCTGGGGATTCTGGTGG + Intergenic
1076582429 10:131520526-131520548 GAGGGAGCCGAAGATGCTGGAGG - Intergenic
1076783121 10:132735420-132735442 GAGTGTTCTGGGAATGCTGGAGG + Intronic
1077135923 11:998652-998674 GAGCGTTCTGGAGATGTGGAGGG - Intronic
1077137040 11:1005391-1005413 GAACGTTCTGGAGATGGTGGTGG + Intronic
1077277231 11:1718473-1718495 GAGCCATCTGAAGAAGCTGGGGG + Intergenic
1077364571 11:2156366-2156388 GAGCTGTCTGATGATGATGGTGG - Intronic
1085868031 11:80317726-80317748 GAGAGTGTTGAAAATGCTGGAGG - Intergenic
1087529038 11:99355551-99355573 GGGCGTTCTGTGGATGATGGTGG + Intronic
1089311529 11:117561207-117561229 GAGGGATCTGAAGATGCAAGAGG - Intronic
1092924292 12:13259527-13259549 GAGCATTCTGATCGTGCTGGGGG + Intergenic
1094404802 12:30106132-30106154 GAGCTTTATTAAGATGCTGGAGG + Intergenic
1099735421 12:86562391-86562413 GAGGATGCTGATGATGCTGGGGG + Intronic
1102570656 12:113825227-113825249 GAGCGTGCAGAAGGTGCGGGAGG + Intronic
1102656129 12:114483813-114483835 GCCCCTTCTGAAGAGGCTGGAGG + Intergenic
1103786359 12:123436192-123436214 CCGCGTCCTGGAGATGCTGGAGG - Exonic
1103800230 12:123533287-123533309 GCGCGTCCTGGAGATCCTGGAGG - Exonic
1106196581 13:27499113-27499135 GAGCTATCAGAAGATTCTGGTGG + Intergenic
1106232592 13:27832732-27832754 AAGAGTTCTGGAGATGATGGTGG + Intergenic
1107626677 13:42293746-42293768 TAGGGTTTTGAAGATGCCGGGGG - Intronic
1110060461 13:71033062-71033084 GAGAGTTCAGGTGATGCTGGGGG - Intergenic
1112484164 13:99804854-99804876 AAAAGTTCTGGAGATGCTGGTGG - Intronic
1113300169 13:109010984-109011006 GAGTCCTCTGAAGAGGCTGGAGG - Intronic
1113743519 13:112726618-112726640 GGGGGTGCTGCAGATGCTGGGGG + Intronic
1113777522 13:112956568-112956590 GAGTTTTCAGAGGATGCTGGAGG + Intronic
1115948766 14:38695321-38695343 GAGCCATCTGGAGGTGCTGGTGG - Intergenic
1122839326 14:104447584-104447606 GAGCGGTCAGTGGATGCTGGGGG - Intergenic
1122932556 14:104941226-104941248 GAGCATTCTGAAGATGATAAAGG + Exonic
1123582761 15:21731156-21731178 GAGCGCTCAGAAGAAGCAGGGGG - Intergenic
1123619411 15:22173752-22173774 GAGCGCTCAGAAGAAGCAGGGGG - Intergenic
1125102434 15:35930072-35930094 CTGCCTTCTGAAGATGCTGATGG + Intergenic
1133318086 16:4896291-4896313 GAGAGTTCTTAAGAAGCTGCGGG - Intronic
1133513447 16:6483317-6483339 GGGCGTTCTGCACCTGCTGGCGG + Intronic
1135705525 16:24671410-24671432 TGGGGTGCTGAAGATGCTGGTGG + Intergenic
1136295594 16:29300122-29300144 GAGAGTTCTGTGGATGGTGGTGG + Intergenic
1136619720 16:31420286-31420308 GAGGGTTCTGCAGGTGGTGGAGG + Intronic
1138122110 16:54408721-54408743 GAGATTTCTGTAGATACTGGAGG - Intergenic
1141248044 16:82329186-82329208 GAGCGTTGGGAAAATGATGGTGG - Intergenic
1142101509 16:88274309-88274331 GAGAGTTCTGTGGATGGTGGTGG + Intergenic
1147119956 17:38330091-38330113 GAGCGTTCTGTTGGTTCTGGAGG + Exonic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1148046356 17:44747384-44747406 GGGCACTCTGAAGATGCTGCCGG - Exonic
1151555299 17:74843442-74843464 CAGCGTGCTCAAGATGCTGCAGG - Exonic
1154228534 18:12531404-12531426 GAGAGTTCTGAAGAAAATGGAGG - Intronic
1155281734 18:24247371-24247393 AAGTGTTGTGAGGATGCTGGAGG + Intronic
1158829465 18:61261879-61261901 GAGTGTTTTGAAGATGCTTGAGG - Intergenic
1158912444 18:62078509-62078531 GAACGTGGTGAAGATGCTGAAGG - Intronic
1160463646 18:79057937-79057959 AAGGGTTCTGGAGATGATGGTGG - Intergenic
1161245707 19:3250563-3250585 GAAAGTTCTGGAGATGATGGTGG - Intronic
1161334163 19:3703178-3703200 GAACATTCTGGAGATGATGGCGG + Intergenic
1161476878 19:4491178-4491200 GAAAGTTCTGGAGATGATGGTGG - Intronic
1161491100 19:4562118-4562140 GAAAGTTCTGGAGATGGTGGTGG - Intergenic
1161491342 19:4563592-4563614 GAAAGTTCTGGAGATGGTGGTGG - Intergenic
1161556592 19:4946116-4946138 GAAAGTTCTGGAGATGGTGGTGG - Intronic
1161866955 19:6840059-6840081 AAGTGTTCTGGAGATGATGGTGG - Intronic
1161906231 19:7158657-7158679 GAAAGTTCTGGAGATGATGGTGG + Intronic
1161928956 19:7323340-7323362 GAACGTTCTGGAGATGATAGTGG - Intergenic
1166232568 19:41433723-41433745 GAAGGTTCTGAAGAGGCTGGAGG - Intronic
1166353774 19:42215237-42215259 TAGCGTTCTGGAGACACTGGAGG + Exonic
1167609914 19:50502040-50502062 GAGGGCTCTGCAGAGGCTGGCGG - Intergenic
1167636937 19:50660705-50660727 GAGAGCACTGAAAATGCTGGGGG + Intronic
1168705641 19:58468817-58468839 GTGCCATCTGAAGATGGTGGGGG + Intronic
925084778 2:1099520-1099542 GAGTGCCCTGAAGAGGCTGGAGG + Intronic
925691389 2:6526982-6527004 GAGTGTTCTGAACATGATTGAGG + Intergenic
926166088 2:10522761-10522783 GGGGGTGCTGAAGAGGCTGGGGG - Intergenic
926733016 2:16051427-16051449 GAGGCTTCTGAAGATGCAGAGGG - Intergenic
927864965 2:26582444-26582466 GGGGGATCTGAAGATGCTGGTGG - Intronic
931879741 2:66555981-66556003 GAGCTTTCTGTAGACGCTGAGGG + Intronic
933791937 2:85889752-85889774 GAGCATTTTGAAAATACTGGAGG + Intergenic
934849899 2:97691468-97691490 GAGCTATCTGATCATGCTGGAGG + Intergenic
938099720 2:128490491-128490513 GAGGGTTCTGCAGAGGCAGGCGG + Intergenic
938276372 2:130028386-130028408 CTGGGTTCTGAAGTTGCTGGTGG + Intergenic
938711527 2:133979637-133979659 GAGCTTTCTCCAGTTGCTGGTGG - Intergenic
939093989 2:137811558-137811580 GAGAGTTCTGAAGAGGCAGAGGG + Intergenic
940803142 2:158154844-158154866 GAGCAACCTGAAGATGCAGGAGG - Intergenic
940870836 2:158858944-158858966 AACCGTTCTGGAGATGATGGCGG + Intronic
943070976 2:183140288-183140310 GGGGGTTCTGAAGATGGTAGGGG - Intronic
948563998 2:238871949-238871971 AAGAGTTCTGGAGATGATGGTGG + Intronic
1168927990 20:1598677-1598699 GAGAGTCCTGAGGATGCTGAGGG + Intronic
1172293475 20:33791968-33791990 GAGCTGTCTGAGGATGCTGTGGG - Exonic
1174117603 20:48237970-48237992 GAGGGTTCTCAAGGGGCTGGGGG - Intergenic
1175072230 20:56344255-56344277 GAGCGTGCTGGAAATGCTGATGG + Intergenic
1175077673 20:56389840-56389862 GAGCCTACAGAATATGCTGGTGG - Intronic
1179621920 21:42622020-42622042 AAGCCTTCGGAAGATGCCGGGGG - Intergenic
1180095273 21:45553553-45553575 AAGAGTTCTGGAGATGATGGGGG - Intergenic
1180508179 22:16040539-16040561 GAGCGTTTTGAGGACTCTGGTGG - Intergenic
1181150817 22:20882021-20882043 CAGAGATCTGAAGATGCTGCTGG + Intronic
1182777627 22:32842462-32842484 GAAGGTTCTCAAGATCCTGGGGG + Intronic
1184031729 22:41899092-41899114 AAAGCTTCTGAAGATGCTGGGGG - Intronic
1184384910 22:44168447-44168469 GAGCGTCCTGGACATGGTGGTGG + Intronic
1184769338 22:46588601-46588623 GAGCGATCTGAAGATGTTCCTGG + Intronic
951627751 3:24684823-24684845 GAGGTTTCTGACAATGCTGGAGG + Intergenic
952176270 3:30866670-30866692 TTGCGTTCTGAACATGGTGGAGG - Intronic
953367283 3:42356195-42356217 GACCATTCTGAAAATGCTAGGGG + Intergenic
954914219 3:54135279-54135301 GAACGTTCTGTGGATGCTGCAGG - Intronic
957808408 3:85183555-85183577 GAGCGTTCTGAAGGCACTGGTGG - Intronic
964345310 3:155749226-155749248 GAGCTTTCTGTACAAGCTGGGGG + Intergenic
964723564 3:159791539-159791561 CAGCTTTCTGCAGCTGCTGGAGG + Intronic
965896235 3:173579844-173579866 GGGAGTTCTGAAGATGGTAGAGG + Intronic
968037922 3:195563864-195563886 GGGTGTACTGAAGATGCTGAAGG + Intergenic
972326725 4:38023435-38023457 AAAAGTTCTGGAGATGCTGGTGG - Intronic
975436007 4:74352316-74352338 GAGCTTTCTGAGGGAGCTGGGGG - Intergenic
979404635 4:120294687-120294709 CAGCCTTCTGCAGATGATGGAGG + Intergenic
980546281 4:134267366-134267388 GCTAGTTCTGAAGATGCTGAAGG + Intergenic
981756592 4:148146407-148146429 GAACGTTCTGAAGCTCCAGGAGG - Intronic
983422031 4:167531458-167531480 GAGAATTCTGAACATGTTGGGGG + Intergenic
985327079 4:188783003-188783025 AAGAGTTCTGAGGATGCTGTGGG - Intergenic
985802293 5:2012608-2012630 GAAGGGTCTGAAGATGCTGCCGG + Intergenic
986126106 5:4883621-4883643 CAGCCTTCTGCGGATGCTGGAGG - Intergenic
990438928 5:55824317-55824339 GAACATTCTTATGATGCTGGTGG - Intergenic
991417390 5:66406705-66406727 GAGAGTTCAGAAGAGTCTGGTGG + Intergenic
993143215 5:84060405-84060427 GAGCGTTCTGAAGATGCTGGAGG + Exonic
995567880 5:113450786-113450808 GACCTTACTGAAGATGCTGATGG - Intronic
997709304 5:135990533-135990555 GAGGGTGCTGGAGGTGCTGGAGG + Intergenic
1001724688 5:173887333-173887355 GAGAATTCAGAAGATGCTGTTGG + Intergenic
1002181176 5:177431855-177431877 GAGGGTTCTGAAGAAGATTGTGG + Intronic
1002917469 6:1540920-1540942 GAAGGTTCTGGAGATGGTGGTGG - Intergenic
1004310248 6:14539240-14539262 GAGGGGTCTCAAGAGGCTGGTGG + Intergenic
1007009858 6:38405927-38405949 AAGCTTTGTGAAGATGCTGGGGG + Intronic
1007737768 6:43992435-43992457 GAGTGGTCTGATGGTGCTGGTGG + Intergenic
1007919541 6:45593963-45593985 GGGGGTTATGCAGATGCTGGTGG + Intronic
1013618117 6:111863733-111863755 GTGCCTTTTGAATATGCTGGTGG - Intronic
1013841347 6:114398179-114398201 GAGTGGACTGAAGATGGTGGGGG - Intergenic
1014468900 6:121790462-121790484 GAGCTTTTTGAAGATACTGCTGG - Intergenic
1014966183 6:127755121-127755143 ACGTGTTCTGTAGATGCTGGCGG - Intronic
1015242199 6:131037190-131037212 TAGCGTTCTGTAGATGCTTGTGG - Intronic
1016789783 6:148056020-148056042 CAGCGTCCTTAATATGCTGGAGG + Intergenic
1017224363 6:152003033-152003055 AAGAGTTCTGAAGAAGCTGATGG - Intronic
1017922277 6:158882902-158882924 TAGTGTGCTGGAGATGCTGGAGG + Intronic
1017936252 6:159007836-159007858 GAGCATTTTGAGGAAGCTGGGGG + Intergenic
1019374041 7:679617-679639 GAAGGTTCTGGAGATGGTGGTGG + Intronic
1019489327 7:1304288-1304310 GAACGTTCTGGAGATGATGGTGG - Intergenic
1019503420 7:1377147-1377169 GAGCATTCTGGAGATGATGGTGG + Intergenic
1020647740 7:10835700-10835722 GAGCGTTCCGAACATGCAGCTGG - Intergenic
1021184064 7:17542490-17542512 CACTGTTCTGTAGATGCTGGAGG - Intergenic
1023048635 7:36232705-36232727 GAGAGTTCTGTGGAGGCTGGGGG + Intronic
1024881567 7:54091450-54091472 GTGTGTTCTGAGGCTGCTGGGGG + Intergenic
1024934379 7:54698104-54698126 GAGTGTTCTGCAGAGGCTTGGGG + Intergenic
1029440338 7:100583739-100583761 GACCGTTCTGGAGAGGGTGGGGG + Intronic
1031923665 7:127619365-127619387 GACCAGTCTGAGGATGCTGGAGG - Intergenic
1032464405 7:132134810-132134832 GAGGGTTCTGAAGGTGGAGGAGG - Intronic
1032611114 7:133415377-133415399 GAGCCCTCTGATGCTGCTGGTGG - Intronic
1039840088 8:41286805-41286827 GATCTTTCTGAAGAAGGTGGAGG - Intronic
1041711482 8:60898686-60898708 CAGCTTTCTTAACATGCTGGGGG + Intergenic
1042393006 8:68257408-68257430 CAGCAATCTGAAGAGGCTGGTGG + Intergenic
1047176530 8:122546260-122546282 GAACGTTATGAAGAAGCAGGAGG + Intergenic
1047288893 8:123511794-123511816 GGGTGTTCTGAAGTTGCTGAAGG + Intronic
1049282300 8:141756187-141756209 GATCGTGATGATGATGCTGGTGG + Intergenic
1049720984 8:144115420-144115442 GAGCCTCCCGAAGATGCCGGAGG - Exonic
1049797989 8:144505245-144505267 GACGGTGCTGAAGCTGCTGGTGG + Exonic
1053278181 9:36798936-36798958 GAGGTTTCTGAAGCTGCTGCTGG - Intergenic
1055659377 9:78487126-78487148 GAGCCTTCTCAAGCTGCTAGAGG - Intergenic
1055865938 9:80813891-80813913 GAGTGTGCTGAGGATACTGGGGG + Intergenic
1059281047 9:113134425-113134447 GAGTCTTCTGAAAATGCTGTAGG - Intergenic
1061108316 9:128549607-128549629 GAGAGTTCTGGAGAGGATGGTGG - Intergenic
1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG + Intronic
1061584136 9:131555265-131555287 GGGCGTTCTGGGGATGGTGGAGG + Intergenic
1061816800 9:133202206-133202228 GAGTGTTCTGAAGCTGCCAGGGG + Intergenic
1196846987 X:119904239-119904261 GAGCATTCTAAAGTTGGTGGTGG - Intronic
1199458314 X:148054252-148054274 GAGGGTGCTGAGGATGCTGAGGG + Intergenic
1199735114 X:150678833-150678855 GATGGTACTGAAGTTGCTGGTGG + Intergenic