ID: 993149935

View in Genome Browser
Species Human (GRCh38)
Location 5:84148526-84148548
Sequence TGTAGCTTAAAGACTTAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993149934_993149935 17 Left 993149934 5:84148486-84148508 CCAACTCTTTATCAATTTTGGCT 0: 1
1: 0
2: 0
3: 17
4: 186
Right 993149935 5:84148526-84148548 TGTAGCTTAAAGACTTAAATTGG 0: 1
1: 0
2: 1
3: 18
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993149935 Original CRISPR TGTAGCTTAAAGACTTAAAT TGG Intronic
900840300 1:5043440-5043462 TGTAGCTGAAAAACTTACAAAGG + Intergenic
903404391 1:23084225-23084247 GGAAGCTTAAAGTCTAAAATGGG + Exonic
906369535 1:45241054-45241076 TGGAGCTTTAAGACTTGACTAGG - Intronic
906498525 1:46322909-46322931 TGTGGCTTAAAATCTTAAACTGG + Intergenic
907363401 1:53939944-53939966 TGTTGTTTACAGTCTTAAATCGG - Intronic
910440970 1:87251362-87251384 TGATGCTTAATGAATTAAATTGG + Intergenic
911222814 1:95267514-95267536 TGTATTTTAAAGTCTTAAGTGGG - Intergenic
911899924 1:103489950-103489972 TGTTGTTAAAAGAGTTAAATGGG - Intergenic
912794921 1:112687394-112687416 TTTAGCCTGAAGAGTTAAATAGG + Intronic
916780140 1:168017933-168017955 TATAGCTAAAACACTTAAATAGG - Intronic
918673921 1:187257971-187257993 AGTAACTTAAAGAATAAAATTGG - Intergenic
918863270 1:189860512-189860534 TGCAGCTTAAATGATTAAATAGG + Intergenic
919107876 1:193176559-193176581 TGTATATTAAATACTAAAATGGG - Intronic
920701603 1:208222020-208222042 TGTATCTTAAACACTTAAGATGG - Intronic
923757385 1:236804451-236804473 TGGAGTTTAAAAAATTAAATTGG + Intronic
1063164755 10:3451174-3451196 TGAATCTTAATGACTTACATGGG - Intergenic
1063925109 10:10969907-10969929 TGTTGTTTAAACACTTAATTTGG + Intergenic
1067335379 10:45358651-45358673 TGCATCTTAAAGAATTAAAAAGG + Intergenic
1069251085 10:66267833-66267855 TATAGCTTAATATCTTAAATTGG + Intronic
1072271567 10:93782190-93782212 TGAAGCCTAAAGTCTTAAAAAGG - Intronic
1072870219 10:99111366-99111388 TGTAGCTTACAGAATTACAGAGG - Intronic
1074138960 10:110654370-110654392 TGTCTCTTATAGAGTTAAATGGG - Intronic
1077656846 11:4027728-4027750 TGTGGATTACAGATTTAAATAGG + Intronic
1077996853 11:7460735-7460757 TTTAGCTTAAAAACAAAAATTGG + Intronic
1078284959 11:9943236-9943258 GATAGATTAAGGACTTAAATAGG + Intronic
1081268936 11:41060789-41060811 TCTGGCTTAAAGATTTAAGTGGG - Intronic
1085003108 11:73059014-73059036 CTTAGCTTAAAAACTAAAATGGG - Intronic
1086922523 11:92603620-92603642 GGAAGCATAAAGAATTAAATGGG - Intronic
1088055687 11:105573787-105573809 TGTAGCTTAAATATTTTAATTGG + Intergenic
1088566208 11:111175568-111175590 TCTATCTTAAAGACATAAATAGG - Intergenic
1089024261 11:115252266-115252288 TGGAGCTTAAATACTTTCATAGG - Intronic
1089025780 11:115268460-115268482 GGTAGCTTTAAGACTTAATGAGG - Intronic
1092871345 12:12808531-12808553 TGCAGTTGAAAGGCTTAAATCGG + Intronic
1094198473 12:27774594-27774616 TTTAGTTTAAAGACCTTAATTGG + Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1094766939 12:33607459-33607481 TGTAACTTTAAAACTAAAATGGG + Intergenic
1095341037 12:41088534-41088556 TGTATCTTACACACATAAATAGG + Intergenic
1096592786 12:52672829-52672851 AGTAGCTAAAAGAATTAAAAAGG - Intergenic
1099345708 12:81497489-81497511 TGTCACTTAAAGACTAACATGGG - Intronic
1099869269 12:88326169-88326191 TCTCTTTTAAAGACTTAAATAGG + Intergenic
1102467522 12:113138534-113138556 TGTTTCATAAAGACTTAAGTGGG + Intergenic
1106215036 13:27689590-27689612 GGTAGACTAAAAACTTAAATGGG + Intergenic
1108097489 13:46918907-46918929 TGTAGCTTAGAGTTTGAAATTGG + Intergenic
1110097455 13:71546351-71546373 TGTATCTTAAAGATTTACATTGG + Intronic
1110932267 13:81235851-81235873 TGTTGCTTTAAGAATTCAATGGG - Intergenic
1112798530 13:103084452-103084474 TTTAGCTTAAAGAGAAAAATAGG + Intergenic
1114895531 14:26985683-26985705 TGTGGCTTAAAGACTATATTAGG + Intergenic
1115874198 14:37842538-37842560 TGTTTCTTAAGGAATTAAATAGG + Intronic
1119841545 14:77797173-77797195 GGTAGGTTAAAGACTTACAGGGG - Intergenic
1120646150 14:87076854-87076876 CGTAACACAAAGACTTAAATAGG - Intergenic
1120977296 14:90260272-90260294 TGTAGCTTAGAGTCTGAAAGGGG + Intronic
1121389269 14:93560405-93560427 TGCAGCTTAAAGAGTCAACTTGG + Intronic
1126834761 15:52649422-52649444 TGTAACTTAAAAACTCAGATTGG - Intronic
1127512657 15:59657657-59657679 TGGAGCTTGAAGCCTTAAAGTGG + Intergenic
1129632976 15:77281936-77281958 TGTATTTGAAAGAATTAAATGGG - Intronic
1130219119 15:82002963-82002985 ATTGGATTAAAGACTTAAATAGG + Intergenic
1131124134 15:89843881-89843903 TGTAGGTCTAAGACTAAAATAGG + Intronic
1132181844 15:99760580-99760602 TGAAACTTAGAGACCTAAATGGG + Intergenic
1137410309 16:48222612-48222634 TGTGTATTACAGACTTAAATTGG + Exonic
1137913223 16:52400179-52400201 TGTAGTTTTAAGACAAAAATAGG + Intergenic
1138825728 16:60317258-60317280 TGAAGCTCAAAAACTTAATTTGG - Intergenic
1139136183 16:64207384-64207406 AGTAGGATAAAGAGTTAAATGGG + Intergenic
1139821492 16:69724937-69724959 TGTAGCTTAAACACAAAAAAGGG - Intronic
1141208411 16:81953995-81954017 TATAGTATTAAGACTTAAATGGG + Intronic
1141220157 16:82062013-82062035 TGTTGGTTCAAGTCTTAAATTGG - Intronic
1143442910 17:6989429-6989451 TGTAGTTTAAAGTCTTATATTGG + Intronic
1143906428 17:10212930-10212952 TTTAGCTTAAAGATCTTAATTGG + Intergenic
1144298896 17:13904911-13904933 TCTTGCTTAAAAACTTAACTTGG + Intergenic
1147486282 17:40817898-40817920 TGTATCTTAAAGAGTAATATTGG + Intergenic
1147922825 17:43928712-43928734 TGTATATGAAAGCCTTAAATAGG - Intergenic
1148982048 17:51585591-51585613 TGGAGCTAAAAGTCATAAATTGG - Intergenic
1149490007 17:57077829-57077851 TGTAGTTAAAGGACCTAAATTGG + Intergenic
1150940676 17:69690182-69690204 TGTAGTATAAAAAATTAAATGGG - Intergenic
1153595488 18:6720981-6721003 TTTAGCTTAAAGAATTACACAGG - Intergenic
1153902512 18:9630560-9630582 GGTAGGTTGAAGACTTAAAGGGG - Intergenic
1155644273 18:28058468-28058490 TTTACCTTAAAGTCTTCAATAGG - Intronic
1155775756 18:29758387-29758409 TGTAGCTTAAACACTAGACTAGG + Intergenic
1156231061 18:35154284-35154306 TTTAGCTTAAACATTTAATTGGG - Intergenic
1156561004 18:38125478-38125500 TTTAGTTTAAAGATTTTAATTGG - Intergenic
1157634610 18:49138841-49138863 TATAACATGAAGACTTAAATCGG - Intronic
1158470993 18:57736745-57736767 GATGGATTAAAGACTTAAATGGG - Intronic
1158957931 18:62559334-62559356 TATAGGTGAAAGACATAAATAGG + Intronic
1159532275 18:69669777-69669799 TGAAGCTTAATAAATTAAATAGG - Intronic
1159901141 18:74046860-74046882 TGTAACTTACAGATTTAAATGGG - Intergenic
925372666 2:3358497-3358519 TGTATCTTGAAGAGTTGAATTGG - Intronic
926479201 2:13367742-13367764 TGTAACTAAAAGAGTTTAATTGG + Intergenic
926545727 2:14236898-14236920 TGGAGCTTAAAGATGTAAAAGGG + Intergenic
927386681 2:22542496-22542518 TGTTGCTTTATGAGTTAAATAGG + Intergenic
928278858 2:29926383-29926405 TGTATCTTAAAGACTATACTTGG - Intergenic
929790928 2:45022354-45022376 CGGAGCTTATAGTCTTAAATAGG - Intergenic
935577882 2:104729611-104729633 TGTAGCTTAGAGACTGAAGCAGG - Intergenic
937506061 2:122538002-122538024 TATAGCTTAAAGCCCTAATTGGG + Intergenic
939925280 2:148165641-148165663 TGTTACATAAAAACTTAAATTGG - Intronic
941183048 2:162284616-162284638 TGAAGTTTCAAGACTTTAATTGG - Intronic
941685429 2:168443087-168443109 TGTAGCATAGATACTTTAATAGG - Intergenic
942962414 2:181847632-181847654 TGTAGCTGAAAAGCTTAGATGGG + Intergenic
943623629 2:190176767-190176789 TGTATCCTAAAGCCTTAATTAGG + Intronic
946378177 2:219326912-219326934 GGTAGCTTAAAATCTTAAAAGGG - Intergenic
1171021832 20:21591611-21591633 TTTAACTTTAACACTTAAATAGG + Intergenic
1171163529 20:22950493-22950515 TGTAGCTTAAAGCCCTCAAGGGG - Intergenic
1172565854 20:35929923-35929945 AGTAGCTCAAAGACCTTAATAGG + Intronic
1173515120 20:43659826-43659848 TGTTTCTTAAAAATTTAAATAGG - Intergenic
1174775248 20:53337788-53337810 TTTAGCTTAAACACTTTAAAAGG - Intronic
1175564585 20:59962986-59963008 TGTTGCCTAGAGACTTGAATAGG + Intronic
1177036616 21:16051692-16051714 AATAACTTAAAGACTAAAATTGG + Intergenic
1178133689 21:29602054-29602076 AGTGGCTTAAAGACTAAATTTGG - Intronic
951402072 3:22245210-22245232 TGTAGCTGAAAAATTTATATTGG - Intronic
952761368 3:36917413-36917435 TGTTGCTGAAACACTTTAATGGG - Intronic
954822792 3:53346521-53346543 TGTAGCTGAATGAGTTAATTAGG + Intronic
955886600 3:63605802-63605824 TGTAGCTTAAAGCTTTAACCTGG - Intronic
955997534 3:64692686-64692708 TGTACCTTAAAGACTAACAAAGG - Intergenic
957263545 3:77930705-77930727 TGAAATTTAAAAACTTAAATAGG + Intergenic
957390029 3:79552656-79552678 TGTAGCTTGAACTATTAAATTGG - Intronic
958154312 3:89733724-89733746 TGTACTTTAAAGACTTAAATTGG + Intergenic
958945409 3:100356199-100356221 TGTATCTCAAAGACTTCAATGGG + Exonic
959280449 3:104331062-104331084 TATAACTTAAAGAGTAAAATTGG + Intergenic
962423624 3:135249756-135249778 TTGAGTTTAAAAACTTAAATGGG - Intronic
962582479 3:136810657-136810679 TTTAGCTTAAAGACTTCAACTGG + Intergenic
963422666 3:145080432-145080454 TGCAGCTTAAATAATAAAATAGG - Intergenic
963504471 3:146166094-146166116 TACAGCTTAAAGAATTAAAAGGG - Intergenic
963807600 3:149740888-149740910 TGTATTTTAAATACATAAATAGG - Exonic
963857655 3:150271814-150271836 TGTAGCTTAAAAATATACATAGG - Intergenic
963915005 3:150851143-150851165 TTTAACTTAAAGATTTGAATTGG + Intergenic
964068806 3:152607479-152607501 TGTGGATTAAAGATTTAAACTGG - Intergenic
966476639 3:180356217-180356239 TGGAGCTTAAATACTTAAAATGG - Intergenic
967498009 3:190163374-190163396 CATGGATTAAAGACTTAAATGGG - Intergenic
967504308 3:190236715-190236737 TTTAGCTTAAAGATCTTAATTGG - Intergenic
970035341 4:11728577-11728599 AGTAACTTATAGACTTAAAATGG + Intergenic
970058907 4:12007071-12007093 TGTAGATTAATGACTTCCATGGG - Intergenic
970844539 4:20520874-20520896 TGTAACTTAATGACTTTATTTGG + Intronic
971629422 4:28970889-28970911 TGTGGCTTAAAATCTTAAATTGG - Intergenic
971769704 4:30880655-30880677 TGGAGCTTAAAGAAATAAATAGG - Intronic
974353961 4:60788181-60788203 TGTGGCTTAAATACTTAAAGAGG - Intergenic
975265579 4:72362197-72362219 TGTGGAATACAGACTTAAATAGG - Intronic
976987273 4:91317411-91317433 TGTAGCTTATAATTTTAAATAGG - Intronic
977868429 4:102059514-102059536 TGGTGTTTAAAGACATAAATAGG - Intronic
979343226 4:119553606-119553628 TCTAGCTTCAAGTCTAAAATTGG + Intronic
980029135 4:127805375-127805397 TATAGCTTAAAAACATAAATGGG - Intronic
980204594 4:129701376-129701398 TGTAGTTTATAGACTTAATGAGG - Intergenic
980479329 4:133366956-133366978 TGTGGATTAAAAACTTAAAATGG - Intergenic
980664113 4:135906096-135906118 TATGGATTAAAGACTTAAATGGG - Intergenic
983598332 4:169495540-169495562 GATGGATTAAAGACTTAAATGGG - Intronic
983819703 4:172178079-172178101 TGGAGCAAAAAGACTTAAACTGG + Intronic
984478934 4:180274388-180274410 TGTAGCTTCAGCACTTATATTGG - Intergenic
984613013 4:181862475-181862497 TGAAGCTTAAAAGCTTAGATTGG - Intergenic
985339952 4:188940056-188940078 TTTAGTTTAAAGATTTTAATTGG - Intergenic
987741787 5:21918050-21918072 TGTATCTTAAAGATATAAAAGGG - Intronic
988454441 5:31374656-31374678 TGAAGCTTAGTGACTTAAATTGG - Intergenic
988633022 5:32951508-32951530 TGTAGCTTGAACACTTCACTTGG + Intergenic
989605250 5:43238341-43238363 TGGAAATTAAAGAATTAAATTGG - Intronic
990831167 5:59959698-59959720 GATGGATTAAAGACTTAAATGGG + Intronic
991469053 5:66948114-66948136 GGCAGCTTAAAGACTTAAACAGG + Intronic
992096420 5:73366936-73366958 TCTATCTTCAAGACTCAAATGGG - Intergenic
993149935 5:84148526-84148548 TGTAGCTTAAAGACTTAAATTGG + Intronic
993375503 5:87145302-87145324 GATAGATTAAAGATTTAAATGGG - Intergenic
994895104 5:105693120-105693142 TGGAGCTTGAAGAAGTAAATAGG - Intergenic
995599112 5:113776634-113776656 TGTTGCTGAAAGACTGAAAACGG + Intergenic
996254593 5:121383771-121383793 TGTATCTCAAAGACTTACGTAGG + Intergenic
996703394 5:126472316-126472338 TGTAGCTTAAAAAGTCAAACAGG - Intronic
998429148 5:142055345-142055367 GGTAGCTTATAGACTTTAAGGGG - Intergenic
998589091 5:143458564-143458586 TGTAGGATAAATTCTTAAATGGG - Intergenic
1000890090 5:166791742-166791764 TGTAGCTTAAACTCATAATTTGG - Intergenic
1001279918 5:170379292-170379314 TGAAGCTTCATCACTTAAATGGG + Intronic
1002378803 5:178809707-178809729 TGTAGCTTTGAGATGTAAATAGG - Intergenic
1007456978 6:41985928-41985950 AATAGATTAAAGACTTAAACTGG - Intronic
1008429158 6:51394469-51394491 TGTATCTTACAGCCTTAAATAGG + Intergenic
1010520833 6:76834462-76834484 AATAGGTTAAACACTTAAATTGG - Intergenic
1013334508 6:109141535-109141557 TGTAACATAAATACTTCAATGGG - Intronic
1014990244 6:128066496-128066518 TATATCTTAAAGAGTTTAATTGG - Intronic
1015538559 6:134291751-134291773 TGTAGTTTAAAGATTTCAGTTGG - Intronic
1016730409 6:147422081-147422103 TGGAGCTCAAAGGATTAAATGGG - Intergenic
1018366056 6:163120971-163120993 TGTTGCTTAAAGAAAAAAATGGG + Intronic
1020216441 7:6194675-6194697 TGTAGATTAAAAAAGTAAATAGG + Intronic
1021256479 7:18398636-18398658 TATATCTTAAAGAATTCAATGGG - Intronic
1023106323 7:36766269-36766291 TGTAGCTTAAGAACTTAACCAGG - Intergenic
1023720312 7:43086448-43086470 AATGGATTAAAGACTTAAATGGG + Intergenic
1023963436 7:44947257-44947279 TGTATCTTACAGGCTTATATAGG + Intergenic
1024086550 7:45896332-45896354 TGTAGCTCCAAGACTAGAATTGG - Intergenic
1025776573 7:64566304-64566326 TGAAGTTTAAAGAAGTAAATTGG + Intergenic
1026307613 7:69155247-69155269 AGTAGCTTAAAGACTAGCATTGG - Intergenic
1026354437 7:69545057-69545079 TGAAGTTGAAAGACTAAAATGGG - Intergenic
1027356551 7:77361935-77361957 TTTAACTTACAGAGTTAAATAGG - Intronic
1031720173 7:125164860-125164882 AGTAGCATAAAGACCTAGATAGG - Intergenic
1032013803 7:128363316-128363338 TGTTGCTTAAAGAGTTACCTAGG + Intergenic
1032895227 7:136242988-136243010 TGTTGATTAAAGACTAACATGGG + Intergenic
1035769494 8:2135728-2135750 TGTTGTTTAGAGACATAAATGGG - Intronic
1036755842 8:11470617-11470639 AGTAGCTTATAGACTCAAAAGGG - Intronic
1039838228 8:41274752-41274774 TATAGTTTAAAAAGTTAAATTGG - Intronic
1042954114 8:74230295-74230317 TGTAGTTTATACAATTAAATGGG - Intergenic
1043125672 8:76391487-76391509 TTTATCTTAAAAACATAAATAGG + Intergenic
1045763329 8:105636948-105636970 GGTAGATAAAAGACTTAAGTAGG + Intronic
1046910630 8:119622307-119622329 TGGAGGTTAAAGTCCTAAATAGG + Intronic
1049079329 8:140429524-140429546 TGAAGATTAAAGGGTTAAATTGG + Intronic
1049915199 9:310982-311004 AATGGATTAAAGACTTAAATGGG + Intronic
1052581155 9:30356111-30356133 TGTCCCTCAAAGATTTAAATGGG + Intergenic
1055818845 9:80238321-80238343 TGTAGCTTAGTGTCTTAAGTAGG - Intergenic
1056289076 9:85124110-85124132 TGTATCTTATAAACTTATATTGG + Intergenic
1056665981 9:88581176-88581198 AGCAGCTAAAAGACTTAACTTGG - Intronic
1057447829 9:95130587-95130609 TGTAGCTTAAATATTTACTTAGG + Intronic
1058215609 9:102229917-102229939 TGTAGCTTAAAAACTTAGTGAGG - Intergenic
1058775929 9:108283712-108283734 CATAGTTTAGAGACTTAAATTGG + Intergenic
1062635671 9:137489365-137489387 TGAAAATTGAAGACTTAAATGGG + Intronic
1188009671 X:25042513-25042535 AGGACCTTAAAGACTTAAAATGG - Intergenic
1188123852 X:26343500-26343522 TATGAATTAAAGACTTAAATGGG - Intergenic
1188754171 X:33940141-33940163 AATAACTTAAAGACTTTAATTGG + Intergenic
1192143331 X:68663200-68663222 GGTAGCTGAAAGACTTACAGGGG - Intronic
1192719966 X:73684286-73684308 TGTACATTAAATACTTAAATGGG - Exonic
1194571281 X:95557208-95557230 TGTAGTTTAAAACCTTAAAATGG - Intergenic
1197531181 X:127628058-127628080 TATAGATTAATGAATTAAATAGG - Intergenic
1197617298 X:128708296-128708318 GTTATATTAAAGACTTAAATGGG - Intergenic
1198642940 X:138776819-138776841 TGTAGTTTAAAGGCCTAAAATGG - Intronic
1201319794 Y:12685674-12685696 AGTATCTTAAAGAATTAATTAGG - Intergenic
1201691497 Y:16771031-16771053 TGAAGAATAAAGACATAAATAGG + Intergenic