ID: 993151900

View in Genome Browser
Species Human (GRCh38)
Location 5:84173004-84173026
Sequence GGACCTCTGTTTACTTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993151900_993151904 28 Left 993151900 5:84173004-84173026 CCTACTGAAGTAAACAGAGGTCC 0: 1
1: 0
2: 5
3: 25
4: 161
Right 993151904 5:84173055-84173077 TCCATGAGTGCCCAGAAGATAGG No data
993151900_993151901 -9 Left 993151900 5:84173004-84173026 CCTACTGAAGTAAACAGAGGTCC 0: 1
1: 0
2: 5
3: 25
4: 161
Right 993151901 5:84173018-84173040 CAGAGGTCCAGCATGACAACAGG 0: 1
1: 0
2: 0
3: 18
4: 158
993151900_993151902 -6 Left 993151900 5:84173004-84173026 CCTACTGAAGTAAACAGAGGTCC 0: 1
1: 0
2: 5
3: 25
4: 161
Right 993151902 5:84173021-84173043 AGGTCCAGCATGACAACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993151900 Original CRISPR GGACCTCTGTTTACTTCAGT AGG (reversed) Intronic
904474311 1:30755058-30755080 GGTCCTCAGTTGACTCCAGTGGG - Intronic
906255148 1:44343033-44343055 GGACCTCTGTTTCTTTTAGTGGG - Intronic
908802885 1:67898237-67898259 AGACCCCTATTGACTTCAGTAGG + Intergenic
908942486 1:69452494-69452516 GGACAGCTCTTTCCTTCAGTGGG + Intergenic
909789631 1:79659650-79659672 GGAACTCTATTAACTTCAATAGG + Intergenic
910236744 1:85044598-85044620 GGACCTCTTTTTAGTTCAAAGGG - Intronic
910897595 1:92084754-92084776 GAACCTCTATTAACCTCAGTAGG - Intronic
913451671 1:118997037-118997059 GGTCCTCTGTTTATTTTAATTGG + Intergenic
914248299 1:145901750-145901772 TGACCTCTGGTTACTTCCCTTGG - Intronic
916687836 1:167163210-167163232 TGAACACTGTTTAGTTCAGTTGG - Intergenic
917388294 1:174502375-174502397 GAAGCTCTGTGGACTTCAGTGGG - Intronic
918115109 1:181489461-181489483 AGACCTTTGTTTTCTGCAGTGGG + Intronic
918368573 1:183836048-183836070 AAACCTCTGTTTCCTTAAGTGGG + Intronic
919556263 1:199057901-199057923 GGACCAATGTTTACTTCGCTGGG - Intergenic
920584014 1:207139734-207139756 GGACCTATGTTTATTTACGTAGG - Intronic
922626953 1:227057485-227057507 GGACATCAGTGTATTTCAGTAGG - Intronic
1065688241 10:28307265-28307287 GGAAATCTTTCTACTTCAGTTGG + Intronic
1067471109 10:46538807-46538829 GGACATATGTTTACTTCAGTTGG - Intergenic
1068119448 10:52771154-52771176 AGACCCCTATTCACTTCAGTAGG - Intronic
1068963981 10:62893389-62893411 GGATTTCTGTTTTTTTCAGTTGG - Intronic
1069734817 10:70647061-70647083 GGATCTTTGTTTATTTCAATAGG - Intergenic
1070721476 10:78760215-78760237 GGGCCTCTGTTTCCTCCAGTGGG + Intergenic
1071928176 10:90435548-90435570 GGACTTCTGGTTATTTCAGTTGG + Intergenic
1072366879 10:94720512-94720534 TGACCTCTGGGTACTTCAGCAGG - Exonic
1073095582 10:100977753-100977775 AGATCTCTGTTGACTTCATTAGG + Intronic
1075174805 10:120149413-120149435 GAACCCCTGTTAACCTCAGTAGG - Intergenic
1076077493 10:127546914-127546936 GGACTTCTGTGTACTGCAGTTGG + Intergenic
1076078103 10:127553780-127553802 GGGCCTCTGTTTCTTTCGGTGGG - Intergenic
1076639537 10:131904756-131904778 GGTCCTCTCCTGACTTCAGTGGG + Intronic
1078852006 11:15172538-15172560 GGGCCTCTGCATCCTTCAGTGGG - Intronic
1078937977 11:15968845-15968867 GCACCTCGGTTTGCTTCATTAGG - Exonic
1081610944 11:44563125-44563147 GGAGCCCTATTAACTTCAGTAGG + Intergenic
1081950730 11:47040449-47040471 GGACCCCTATTGACTTCAGTAGG + Intronic
1083136771 11:60685892-60685914 AGACCTCTCTTTACTTCACTTGG + Intergenic
1087649365 11:100846927-100846949 AGACCCCTGTTAACTTCAATAGG + Intronic
1088717016 11:112557570-112557592 GTGCCTCTGTTTCCTTCATTTGG + Intergenic
1089073470 11:115718426-115718448 GGCCCTGTGTTTACTCCATTAGG + Intergenic
1089677830 11:120102175-120102197 GGACTTCTGTATACTGGAGTTGG - Intergenic
1090471813 11:126987676-126987698 TGCCTTCTTTTTACTTCAGTGGG - Intronic
1094087184 12:26607104-26607126 GGACCTCCTTAAACTTCAGTGGG - Intronic
1095769529 12:45937591-45937613 AGACATCTGGTTACTTCATTGGG + Intronic
1095977972 12:47952613-47952635 GGACCCCTATTCACTTCAGTAGG + Intergenic
1097818104 12:64097931-64097953 GCATTGCTGTTTACTTCAGTGGG + Intronic
1098005857 12:65996017-65996039 GTAGCTCTGTTTTCTTCACTAGG + Intergenic
1101256417 12:102981848-102981870 GGGCCACTGTTTAGCTCAGTTGG - Intergenic
1101583372 12:106064049-106064071 GGTCCTCTCCTTACTTCTGTGGG - Exonic
1103866903 12:124059954-124059976 GAACCTCTGTTGACATAAGTTGG - Intronic
1105487524 13:20851364-20851386 GGAAATCAGTATACTTCAGTGGG - Intronic
1107715185 13:43192684-43192706 GGATCCCTATTCACTTCAGTAGG - Intergenic
1108188794 13:47916432-47916454 GGATCCCTGTTTCCTTTAGTGGG - Intergenic
1108681634 13:52785755-52785777 TGTCCTCTGTTTATTTCAGCAGG + Intergenic
1109986478 13:69993122-69993144 GGACCCCTATTGACTTCAATAGG + Intronic
1110267719 13:73557455-73557477 GGAGCTCTGTGTCCTTCCGTGGG - Intergenic
1110792628 13:79602098-79602120 GGACCCCTGCAAACTTCAGTAGG + Intergenic
1112588903 13:100745873-100745895 GGTCCTCTGTTTAGTTCTTTTGG - Intergenic
1113088837 13:106596330-106596352 GGCCTTCTTTTCACTTCAGTTGG + Intergenic
1115156094 14:30341002-30341024 GGACCCCTATTAACTTCAGCAGG + Intergenic
1117633332 14:57716212-57716234 GGACCTTTTTTGACTTCAGAAGG - Intronic
1118326539 14:64785392-64785414 GGACCTCTGGGTACTTAATTGGG - Intronic
1119858366 14:77918130-77918152 GGACCCCTGTCAACTTCAGTAGG + Intronic
1121074348 14:91055288-91055310 GGACCTATGTTTATTTCTCTTGG - Intronic
1121924503 14:97915518-97915540 GGAGGTGTGTTTAATTCAGTGGG - Intergenic
1124002584 15:25771180-25771202 GCACCCCTGTTAACCTCAGTGGG - Intronic
1124942797 15:34234124-34234146 GGATCTCTGGTTACTTCACAGGG - Intronic
1125452781 15:39826388-39826410 GGTCCTGTCTTTACTCCAGTTGG - Intronic
1127301723 15:57661538-57661560 GGATCTCTGTTTCTTTAAGTTGG + Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128324185 15:66713035-66713057 GGATCTCTGTTTCCTCTAGTGGG + Intronic
1133444489 16:5848381-5848403 GAACCCCTGTTAACCTCAGTGGG - Intergenic
1135566073 16:23512080-23512102 GTACCCCTATTAACTTCAGTAGG + Intronic
1135609131 16:23849641-23849663 GGACTTCTTTTTATTTCAGTTGG + Intronic
1135956817 16:26962835-26962857 GGACCTCTGTTGACTCCAGTAGG - Intergenic
1136102861 16:28008443-28008465 GGACCCCTCTTAACTTCAGGAGG - Intronic
1140714015 16:77705702-77705724 AGAACTCTGTTTACCTAAGTTGG - Intergenic
1140950115 16:79808814-79808836 TGACCTCTGTTACCTTCACTCGG + Intergenic
1147717546 17:42518593-42518615 GGAACTCTGTTTCCTCGAGTGGG - Intronic
1151855674 17:76719948-76719970 TAAACTCTGTATACTTCAGTAGG - Intronic
1153346445 18:4031088-4031110 GGACCCCTGCTGACTTCAATAGG - Intronic
1154403212 18:14062618-14062640 GGAGCTCTGTTTACCTGGGTGGG + Intronic
1155563918 18:27111606-27111628 GCAATTCAGTTTACTTCAGTGGG - Intronic
1158877344 18:61745826-61745848 AAACCCCTGTTAACTTCAGTAGG - Intergenic
1159003458 18:62992768-62992790 GAACCCCTGTTAACTCCAGTAGG + Intergenic
1160032093 18:75270970-75270992 GGACCTGTGCTTGCTTCAGCTGG + Intronic
1164558375 19:29270552-29270574 GGATCTCTGGTTCCTTCAGGAGG - Intergenic
928545080 2:32322072-32322094 GGACCCCTATTGACTCCAGTAGG - Intergenic
930876951 2:56229616-56229638 GGACCTCTGGTTTCTGCTGTAGG + Intronic
931552300 2:63460506-63460528 GGATGTCTGTTAACTTGAGTGGG - Intronic
931609189 2:64080534-64080556 TGACCTCTGCTTATTTCAGAGGG + Intergenic
933028014 2:77287093-77287115 GGACCTCTGTATCATTCACTGGG + Intronic
933036014 2:77399129-77399151 GGACCCCTATTGACTTCAATAGG - Intronic
933653020 2:84864476-84864498 GGACCCCTATTGACTTCAGTGGG - Intronic
935523964 2:104143297-104143319 AGACCCCTATTAACTTCAGTAGG + Intergenic
937043691 2:118839394-118839416 GAAACTCTCTTTTCTTCAGTAGG - Intergenic
937385559 2:121428728-121428750 TGATCCCTGTCTACTTCAGTAGG - Intronic
938614869 2:132987220-132987242 AGACCCCTATTAACTTCAGTAGG - Intronic
943831233 2:192465145-192465167 AGACTTCAGTTTACTCCAGTTGG - Intergenic
947439591 2:230108085-230108107 GGTGCTCTGTTTAGTTCATTTGG + Intergenic
947971005 2:234324574-234324596 GGACCTCTGGTTGCTTCGCTTGG - Intergenic
1169641866 20:7761124-7761146 GGACCCCTCTTGGCTTCAGTAGG - Intergenic
1172913168 20:38425124-38425146 AGACCCCTGTTTACCTCATTAGG - Intergenic
1172926702 20:38543724-38543746 GGACCTCTTTTTTCTTCACTTGG + Intronic
1174995788 20:55566986-55567008 GGACCCCTGTTAACTTCAGAAGG + Intergenic
1175532003 20:59680182-59680204 GAACCCCTGTTAACCTCAGTAGG + Intronic
1177308481 21:19353315-19353337 GGAACTCTGTTTAAGTAAGTGGG + Intergenic
1177379087 21:20314696-20314718 GGACCTCTATTGACTCCAATAGG - Intergenic
1181388032 22:22558776-22558798 CGACCTCCCTTTTCTTCAGTGGG + Intronic
1181563335 22:23718184-23718206 GGACCCCACTTTACTCCAGTAGG + Intergenic
949791817 3:7801150-7801172 GGGCTTCTCTTTACTCCAGTGGG - Intergenic
949842269 3:8332732-8332754 GGACCTCCATTTATTTCAGTCGG - Intergenic
950170473 3:10835469-10835491 GGACCTCTGTTCACTTCTCCCGG + Intronic
951328214 3:21331749-21331771 GGACCTATGGTTTCTTTAGTGGG + Intergenic
955946934 3:64204365-64204387 GGGCCTTTGTTTTCTTCCGTGGG - Intronic
956849116 3:73212147-73212169 GGACTTCTTTTCACTTCATTGGG + Intergenic
958694139 3:97506513-97506535 AGACCTCTGTTCTCTTCAGTTGG + Intronic
961426928 3:126855759-126855781 GGACCCCTATTAACTTCAGTAGG + Intronic
962898954 3:139740375-139740397 GGACCTCTGGTCACATCACTGGG + Intergenic
964400368 3:156291673-156291695 GGCCGTCTGTTTACTTCTCTGGG + Intronic
965473408 3:169123642-169123664 GGAGCTCTGGTTACTTTATTTGG - Intronic
965605247 3:170491979-170492001 GGTCATCTTTTTACTTGAGTTGG + Intronic
966151934 3:176875183-176875205 AGACCTCATTTTTCTTCAGTGGG - Intergenic
969062069 4:4444329-4444351 AGACCCCTGTTAACTTCAGTAGG - Intronic
969375261 4:6759219-6759241 GGACCCCTGTTGACTTCAATAGG - Intergenic
971255994 4:25013867-25013889 GAACCTCTGTTCACTCCTGTTGG + Intronic
972292980 4:37707838-37707860 GGACTCCTATTAACTTCAGTAGG - Intergenic
972681324 4:41309540-41309562 GGATCTCTATTGACTGCAGTAGG + Intergenic
975252870 4:72199257-72199279 GGTACTCTATTTACTTCATTTGG - Intergenic
976939999 4:90688160-90688182 GGACATCTGTATACTTCATTAGG + Intronic
977472942 4:97464911-97464933 GCTCCTCTGTTTTCTTCAGCTGG + Intronic
979635130 4:122948568-122948590 GGACCCCTATTAACTTCAGTGGG + Intronic
984129455 4:175855973-175855995 TGATCTCTGTTTCCTTCTGTTGG - Intronic
988063141 5:26199586-26199608 GCACCACTGTTTACTTTTGTAGG - Intergenic
989553161 5:42759518-42759540 GGACCACTGTTGACCTCAGGTGG - Intronic
991596776 5:68314580-68314602 AGACCCCTGTTGACTTCAATAGG - Intergenic
993151900 5:84173004-84173026 GGACCTCTGTTTACTTCAGTAGG - Intronic
995479440 5:112580293-112580315 GGACCTCCATTGATTTCAGTAGG - Intergenic
995535935 5:113136313-113136335 AGATCTCTGTTTACATCACTAGG - Intronic
995778243 5:115748214-115748236 GGACCCCTATTGACTCCAGTAGG - Intergenic
997658711 5:135574197-135574219 GGAGCTCTGAGGACTTCAGTGGG - Intronic
999355687 5:150928590-150928612 GGACCTATGGTTTCTACAGTGGG - Intergenic
1001923937 5:175622536-175622558 GGACCCCTGTTGACTCCAGTAGG + Intergenic
1002627888 5:180544733-180544755 GGAGCTCTGTTTGCTTCTTTAGG + Intronic
1004208268 6:13612983-13613005 AGACCTCTGTTAACTTCAGTAGG + Exonic
1005926297 6:30448383-30448405 GGGCCTCAGTTTCCTTCACTGGG - Intergenic
1007067890 6:39011165-39011187 ACACCTCTGTTTACTGCAATTGG - Intronic
1007450648 6:41938865-41938887 GGACCTCTGAGAACTCCAGTTGG - Intronic
1008970306 6:57359444-57359466 GTACCTCTGGTGACTTCATTTGG + Intronic
1009035184 6:58109005-58109027 GAACATCTATTTAGTTCAGTTGG - Intergenic
1009210697 6:60859722-60859744 GAACATCTATTTAGTTCAGTTGG - Intergenic
1011948779 6:92938177-92938199 AGACCCCTATTAACTTCAGTAGG + Intergenic
1013205856 6:107945257-107945279 GGAATTCTGTTTATGTCAGTAGG - Intronic
1013540276 6:111101367-111101389 TTAACTCTATTTACTTCAGTAGG - Intronic
1013622044 6:111899474-111899496 GGACCCTTTTTGACTTCAGTAGG + Intergenic
1017912759 6:158808394-158808416 AGACCTCTGTTGACTTCAACAGG - Intronic
1020997791 7:15285883-15285905 GGCCCTCTGTTTAGTTCCATTGG - Intronic
1021028953 7:15705260-15705282 GGACCAGTGCTTACTTCAGTAGG + Intergenic
1022346146 7:29516405-29516427 GGACCCCTATTAACTTCAGTAGG - Intergenic
1022811445 7:33872723-33872745 GGACCCCTATTGACTTCTGTAGG - Intergenic
1024117113 7:46205029-46205051 GGGTTTCTGTTTGCTTCAGTAGG - Intergenic
1024173989 7:46819475-46819497 TGACCTCTGTTGACACCAGTGGG - Intergenic
1025929597 7:65983048-65983070 GGACCCCAGTTTACTCCAGTAGG + Intergenic
1026196476 7:68177855-68177877 GGCCCTCTGTTTTCTTGAGATGG - Intergenic
1028353261 7:89876264-89876286 GGTCCTCTGTTAGCTTCATTGGG + Intergenic
1030014021 7:105200441-105200463 GGATCTCTGTTTTATTCAGTGGG - Intronic
1030997674 7:116377958-116377980 GAACCCCTGTTGACTCCAGTAGG - Intronic
1033108481 7:138553830-138553852 AGACCTCTGTTGACTTCAGTAGG + Intronic
1035487962 7:159243363-159243385 GAACCTAAGTTAACTTCAGTTGG - Intergenic
1037561985 8:20083557-20083579 GGACCTCTCTTTCCCTCTGTGGG - Intergenic
1038035090 8:23680782-23680804 GGACTTAAGTTTAATTCAGTTGG + Exonic
1038946042 8:32361380-32361402 GGGCTTCTGTTTGGTTCAGTGGG - Intronic
1041278584 8:56189185-56189207 GGACAACTGTTTTCTTCCGTGGG - Intronic
1041341393 8:56849899-56849921 GGACCTCTGTTCTGTTCTGTTGG - Intergenic
1041793572 8:61722834-61722856 GGCCCCCTATTAACTTCAGTAGG - Intergenic
1043946553 8:86260571-86260593 GGACCCCTATTAACTTCAGTAGG + Intronic
1044668784 8:94657763-94657785 TGATCTCTGTCTTCTTCAGTTGG + Intronic
1047780849 8:128109744-128109766 GGACCTCAGTTTCCTCCTGTAGG - Intergenic
1048770715 8:137891603-137891625 GGACCTCCATTGCCTTCAGTGGG - Intergenic
1049141196 8:140955995-140956017 CGACCTCTGTTTTGTACAGTTGG - Intronic
1052075994 9:24141381-24141403 GGACCTCTATTAACTTCAGTAGG + Intergenic
1052288853 9:26819675-26819697 GGAGCTCTGTTACCTTCTGTAGG - Intergenic
1056203071 9:84295140-84295162 AGACCCCTATTGACTTCAGTAGG - Intronic
1058100493 9:100914023-100914045 GGACCCGTGTTTACCTCAATAGG - Intergenic
1059005727 9:110399987-110400009 AGGTCTCTGTTTACTTTAGTGGG - Intronic
1059914514 9:119084348-119084370 TGACCTCTGTTGACATCAGATGG - Intergenic
1186629551 X:11334422-11334444 GGAACTCTCCTTACTGCAGTTGG + Intronic
1186690294 X:11968342-11968364 AGACCCCTATTGACTTCAGTAGG + Intergenic
1186782060 X:12922694-12922716 TGAGCTCTGATTGCTTCAGTTGG + Exonic
1189155024 X:38748308-38748330 AGACATCTCTTTTCTTCAGTTGG + Intergenic
1191646765 X:63489533-63489555 GGTCCTTTGTTTAGTTCATTTGG - Intergenic
1192559043 X:72113393-72113415 AGACCCCTATTGACTTCAGTAGG + Intergenic
1193340160 X:80338725-80338747 TGAACTCTTTTTACTTCAATGGG - Intronic
1194464727 X:94219458-94219480 AGACCCCTATTAACTTCAGTAGG + Intergenic
1198429281 X:136549310-136549332 GGTCCTGTGTTTACCTCATTGGG + Intronic