ID: 993152890

View in Genome Browser
Species Human (GRCh38)
Location 5:84183299-84183321
Sequence GTTGATGCTCTGAGGGGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993152890_993152898 -10 Left 993152890 5:84183299-84183321 CCTATACCCCTCAGAGCATCAAC 0: 1
1: 0
2: 0
3: 10
4: 86
Right 993152898 5:84183312-84183334 GAGCATCAACTAACTGGGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 121
993152890_993152899 -9 Left 993152890 5:84183299-84183321 CCTATACCCCTCAGAGCATCAAC 0: 1
1: 0
2: 0
3: 10
4: 86
Right 993152899 5:84183313-84183335 AGCATCAACTAACTGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993152890 Original CRISPR GTTGATGCTCTGAGGGGTAT AGG (reversed) Intronic
906713972 1:47953215-47953237 GATGATGCACAGAGGGGTGTGGG + Intronic
908475365 1:64482532-64482554 GTTGCTGCCCTGAGTGGTTTTGG + Intronic
911378445 1:97080947-97080969 GCTGATGCTCTGATAGTTATAGG + Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
915009856 1:152675466-152675488 GTTGAGGCTCTGAGGCCTACCGG + Intronic
917583722 1:176403780-176403802 GTTGATGATCAGATGGCTATTGG + Intergenic
919397433 1:197068776-197068798 GTTGTGGCTCTGTGGGGAATGGG - Intergenic
923384515 1:233453173-233453195 GTTGAGGCTGTGATGGGGATGGG + Intergenic
924185588 1:241485937-241485959 GTAGATGCTTCGAGGGATATGGG - Intergenic
1068442034 10:57069218-57069240 GTTGTTCCTCTGGGGGGTTTCGG + Intergenic
1069247004 10:66219202-66219224 GATGAGGCTTTGTGGGGTATCGG + Intronic
1078091421 11:8266865-8266887 GGTGATGCTCAGAGAGGTATTGG + Intronic
1078161125 11:8840483-8840505 GTTGGTGCTGGGAGGGGTGTGGG - Intronic
1079933160 11:26590088-26590110 GATGATGCTTTGAGGGTTAAAGG + Intronic
1082953675 11:58846307-58846329 GTTGGTGCCTTGTGGGGTATGGG - Intronic
1086055404 11:82640484-82640506 GTGGATGCTCTGACTGGGATGGG - Intergenic
1086413247 11:86563739-86563761 GTTGATGATCAGATGGTTATAGG + Intronic
1089211728 11:116808603-116808625 GTTGAGGCTCTTTGTGGTATGGG - Intergenic
1095812710 12:46387460-46387482 GTTGATGGCCTGAGGGTTCTTGG + Intergenic
1097610996 12:61820133-61820155 TTTGATGTACTGAGGAGTATTGG - Intronic
1101139225 12:101777938-101777960 CTTGATGCTCTGAGAGGTGTTGG + Intronic
1102888193 12:116537422-116537444 GTTGAGGCTCTGAGAGGGACTGG + Intergenic
1104272158 12:127292483-127292505 GTGGCTGCTCTGATGTGTATGGG + Intergenic
1107183139 13:37485452-37485474 GGTGCTCCTCTGAGGGGGATTGG - Intergenic
1107405482 13:40108483-40108505 GTTGATGCTCTTAAAGGTACTGG - Intergenic
1107926792 13:45270897-45270919 GTTGAAGTTCAGAGTGGTATTGG - Intronic
1108097289 13:46916678-46916700 GTTGATGCCATGAGGGATATTGG + Intergenic
1116020240 14:39451915-39451937 GTTGTTTCTCACAGGGGTATTGG + Intergenic
1121289634 14:92763385-92763407 ATTTATTCTCTGAGGGATATCGG + Intergenic
1123821355 15:24033757-24033779 GTTGAAGATCAGAGGGTTATAGG - Intergenic
1127562420 15:60152465-60152487 GTTGAGGCTCAGAAGGGTAAAGG - Intergenic
1133148357 16:3807675-3807697 GTTGAGACTCTGAGGAGTTTGGG - Intronic
1135188052 16:20331984-20332006 GGGGATGCTTTGTGGGGTATGGG - Intergenic
1142575033 17:901247-901269 GTTGAGGCTCAGAGGGGTTTTGG - Intronic
1143375108 17:6462731-6462753 GATGATGATCTGAGGGATCTGGG + Intronic
1146618905 17:34380940-34380962 GGTGAGGTTCTGAGGGGTAAAGG - Intergenic
1147667885 17:42160132-42160154 GGTCAGGCTCTGAGGGGTAGGGG + Exonic
1151153893 17:72111067-72111089 GGTGATGCACTGAGGGGTCATGG - Intergenic
1155536861 18:26827763-26827785 CTTGAGGCTCAGAGGGGAATAGG + Intergenic
1155768994 18:29673012-29673034 GGTGATGAGCTGAGGGGTAAGGG - Intergenic
1158459679 18:57635023-57635045 GTTGAGGCTCCAAGGGGTCTCGG + Intergenic
1162977710 19:14218003-14218025 GTTGCTGGTCTGAGGGATCTGGG - Intergenic
1163830102 19:19543530-19543552 GTTGGTGCTCAGAGTGGTATGGG - Intronic
1165126756 19:33603531-33603553 GCTGAGGCTCTGCGAGGTATAGG + Intergenic
925652275 2:6104038-6104060 GTGGACTCTCTGAGGGTTATTGG + Intergenic
930141506 2:47955410-47955432 GTTGAAGATCAGAGGGGCATAGG - Intergenic
932114147 2:69030672-69030694 GTTTATTCTCTGTAGGGTATAGG - Intronic
933886551 2:86722936-86722958 ATTTATGGTTTGAGGGGTATTGG + Intronic
933923629 2:87073769-87073791 ATTTATGGTTTGAGGGGTATTGG - Intergenic
936164451 2:110107508-110107530 GTTGCTGCTGTGAGGGGTAAAGG - Intronic
937642433 2:124228856-124228878 TTTGATGCTCTGAAGGTCATGGG - Intronic
938953501 2:136278451-136278473 GTTCATGGGCTGAGGGGTTTGGG - Intergenic
941364294 2:164591605-164591627 GTTGTTGGTCTGAGGGCCATTGG + Intronic
947752401 2:232539864-232539886 ATGGAGGGTCTGAGGGGTATTGG + Intronic
948854615 2:240724389-240724411 GGGGCTGCTCTGTGGGGTATGGG - Intronic
1171379691 20:24724988-24725010 ATTGTTGCTGTGAGGGGTCTAGG + Intergenic
1171380846 20:24732894-24732916 GCTGCTGCTCTGAGGAGTGTAGG + Intergenic
1178915624 21:36704289-36704311 TCTGACGCCCTGAGGGGTATAGG - Intronic
1180855453 22:19042210-19042232 GGTGATGGTCAGAGGGGTGTTGG - Intronic
1181571881 22:23772411-23772433 GTTGAGGCTCTGAGGGGTGGGGG + Intronic
1183641552 22:39095931-39095953 GTTTATGATCTGAAGGGTGTTGG + Intergenic
954224706 3:49174247-49174269 GTGTATGCTCTGGGGGGAATGGG + Exonic
955797763 3:62655515-62655537 ATTTATGCTCTGAGGGATTTTGG + Intronic
958705869 3:97654732-97654754 GTTGATACCCTGAGAGGTAGGGG + Intronic
963912075 3:150823456-150823478 GTTGATGCTGTGATGGGGATGGG + Intergenic
965556161 3:170020562-170020584 ATGGATGCTGTGAGGGTTATGGG + Intergenic
966901302 3:184488051-184488073 GTTGAAGATCTGATGGTTATAGG + Intronic
969525598 4:7702458-7702480 GCTGAGGCTCTGAGGGGTGGAGG - Intronic
969567240 4:7985716-7985738 GGTGACACTCTGAGGGGGATGGG + Intronic
969997390 4:11326784-11326806 GCTGATGCTCTGTAGGATATGGG + Intergenic
973728493 4:53800378-53800400 TTTGATGTTCTGAGGAGGATGGG - Intronic
974575620 4:63716543-63716565 GTTGATACTCTGTGGTGTGTGGG - Intergenic
976173329 4:82326858-82326880 GTTGATACTCTCAGGGGTTCTGG + Intergenic
977458017 4:97286918-97286940 GTCAATGCTCTGATGGTTATGGG - Intronic
979099588 4:116598723-116598745 GTTGATGATCTGTGGGGTGACGG - Intergenic
981954181 4:150449353-150449375 GTGGATGCCATGAGGGGTAGAGG + Intronic
982582253 4:157193940-157193962 GTTTATGCTCTTGGGGCTATTGG + Intergenic
986527287 5:8693955-8693977 TTTGATGCTCTGAGGGTGAGTGG + Intergenic
990303484 5:54472513-54472535 CTTCATGCTCTGGGGGGTAATGG + Intergenic
993152890 5:84183299-84183321 GTTGATGCTCTGAGGGGTATAGG - Intronic
1001421184 5:171588531-171588553 GGTGATTCTCTGAGGGATTTAGG + Intergenic
1006802082 6:36765800-36765822 GTTGAGGGTCTGAGGGCTTTGGG + Intronic
1009443074 6:63705542-63705564 CTTGATGATCTGAGGTGTAATGG + Intronic
1020548853 7:9572348-9572370 GTTGATCCTCTGATGGTTATGGG - Intergenic
1022332579 7:29394485-29394507 GATGAGGCTCTGACGGGTAAGGG - Intronic
1030942042 7:115663389-115663411 TTTGATCCACTGAGGGTTATTGG - Intergenic
1047832468 8:128650603-128650625 GTTGATGCTCTGAGAAGTGATGG - Intergenic
1051076399 9:13242711-13242733 GTAGATTATATGAGGGGTATTGG - Intronic
1051613198 9:18981513-18981535 ATTGATGCTGTGAGGGCTCTGGG - Intronic
1052786809 9:32836021-32836043 ATTGATGCACTGTGGAGTATAGG + Intergenic
1056317345 9:85402792-85402814 GTTTGTGCTCTGAGGTGTATCGG + Intergenic
1187092125 X:16107645-16107667 GTTAATACTCTGGGGGCTATTGG + Intergenic
1189690418 X:43612180-43612202 GTCGATGCTCTTTGGGGTCTGGG + Intergenic
1192319070 X:70074682-70074704 GTTGATGGGCTGAGGGGAGTGGG - Intergenic
1193062742 X:77223498-77223520 GTTGATGCTGTGGGGGATAGGGG - Intergenic
1194875029 X:99176355-99176377 GTTGAAGATCTGAGGGATGTAGG - Intergenic
1197013922 X:121601091-121601113 GTTGAAGATCAGATGGGTATAGG + Intergenic