ID: 993153764

View in Genome Browser
Species Human (GRCh38)
Location 5:84195473-84195495
Sequence TTGTGTGACCTAATTGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993153763_993153764 13 Left 993153763 5:84195437-84195459 CCTGATCAGTACAGTAAAGTTTT 0: 1
1: 0
2: 0
3: 6
4: 155
Right 993153764 5:84195473-84195495 TTGTGTGACCTAATTGAAGTAGG 0: 1
1: 0
2: 1
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993153764 Original CRISPR TTGTGTGACCTAATTGAAGT AGG Intronic
902522543 1:17028645-17028667 TTTTGAGACCTTATTGAGGTTGG + Exonic
909058938 1:70856505-70856527 ATTTGTGACCTACTTGAATTGGG - Intronic
912721828 1:112026720-112026742 TTCTGTGACCTAAATGCATTTGG + Intergenic
914449220 1:147775829-147775851 TTGTTTGACCTCATTGACTTGGG - Intergenic
916013715 1:160729590-160729612 TTGTGTGAACTAATTGCTGCAGG + Intergenic
917337267 1:173938352-173938374 TTGTATGATCTTAATGAAGTAGG - Exonic
917559812 1:176138473-176138495 TTGTGTGACATATTTTAAGGCGG - Intronic
922065624 1:222136893-222136915 TATTGTGACCTAAAGGAAGTCGG + Intergenic
923956363 1:239026307-239026329 TTTTGTGCCCTAATTAAACTGGG - Intergenic
924305074 1:242679841-242679863 TTGCGTTACCGAATTGAACTTGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1064314018 10:14237942-14237964 TTGAGTGACCCAAGTGGAGTAGG - Intronic
1064785280 10:18888054-18888076 TTGTATGAACAAATTGAAGATGG - Intergenic
1068650911 10:59521747-59521769 TTGTTTAACCTATTTTAAGTTGG - Intergenic
1071713998 10:88076836-88076858 TTGGTTGCCCTAATTAAAGTGGG - Intergenic
1073741542 10:106413277-106413299 TTGTGAGACTTAATTGAATCTGG - Intergenic
1074632794 10:115276645-115276667 TTGTTTGACCTATATGAAATAGG - Intronic
1074866809 10:117548996-117549018 TTGTGCAAGCTAAATGAAGTAGG + Exonic
1078407932 11:11087396-11087418 TTCTGTGTCCTCATTCAAGTTGG + Intergenic
1079311251 11:19367937-19367959 TTATGTGTCCTAATGGAAGGAGG - Intronic
1079923280 11:26458436-26458458 TTGTGTTACCTATTTTAACTAGG - Intronic
1085332552 11:75666247-75666269 TTCTGTTAGCTAATTGATGTTGG + Intronic
1098457169 12:70687661-70687683 TTGGGTGACCTAAAGGAAGTAGG + Intronic
1098466512 12:70793128-70793150 ATTTGTGCCCTAATTGAAGAGGG + Intronic
1099541666 12:83917321-83917343 GTTTGTGCCCTAATTGAAGAGGG - Intergenic
1099629972 12:85130237-85130259 TTTTGTTACCTGATAGAAGTGGG + Intronic
1102988914 12:117300734-117300756 ATACCTGACCTAATTGAAGTAGG + Intronic
1103070303 12:117935799-117935821 TTGTGTGACCAGAGTGGAGTGGG - Intronic
1104373691 12:128246052-128246074 TTGAATGACCTAATTCAATTTGG + Intergenic
1104480131 12:129100341-129100363 TTCAATGACCTAATTAAAGTGGG - Intronic
1105925340 13:25002719-25002741 TGGTTTGACTTAAGTGAAGTGGG - Intergenic
1108843405 13:54649725-54649747 TTGTGTGACAGAATTTAACTAGG + Intergenic
1111998486 13:95188569-95188591 TTGTGTGACTTTATTGAAATGGG - Intronic
1112147837 13:96721367-96721389 TTCTATGACCAAATTGAACTGGG + Intronic
1112724172 13:102282759-102282781 TAGTGTGACCTAATAGTGGTTGG - Intronic
1114755282 14:25252864-25252886 GTGTGTGACGTTATTGAAGTAGG + Intergenic
1116515340 14:45798027-45798049 TTGCGTGACCTAATTTGAGTTGG + Intergenic
1119327697 14:73771196-73771218 TTCTGTGATCAGATTGAAGTAGG - Intronic
1125173288 15:36791849-36791871 TTGTGTGAAGTTATTGATGTAGG - Intronic
1129525418 15:76210683-76210705 TTATGAGGCCTAATTGATGTTGG - Intronic
1130759298 15:86801533-86801555 TTATGAGACTTCATTGAAGTAGG - Intronic
1132369960 15:101289069-101289091 TTTTGTGACATATTTGAAGATGG - Intronic
1133243991 16:4434537-4434559 TTTGGTGACCAAATTGTAGTAGG + Intronic
1133710259 16:8394540-8394562 TTCTGTGTTCTACTTGAAGTAGG - Intergenic
1139549415 16:67665218-67665240 GTGTGTGAACTAGTGGAAGTTGG - Intronic
1151053953 17:71010900-71010922 CTGTGTGACCTCATGTAAGTGGG + Intergenic
1157752464 18:50192098-50192120 GTTTGTGCCCTAATTGAAGAGGG + Intronic
1164434174 19:28214761-28214783 TTGAGTGACCTTATGGAGGTAGG - Intergenic
1165931533 19:39362346-39362368 TTGTGTGACCTACTAGAAGTGGG + Intronic
926551887 2:14310959-14310981 ATGTTTGACCTAAAAGAAGTTGG + Intergenic
929173202 2:38952140-38952162 TTGTGTGGGCTAATTAAAATTGG + Intronic
933066133 2:77799538-77799560 TTGTTTTACCTTATTGCAGTGGG - Intergenic
935040778 2:99424891-99424913 TTGAGGGACCTAATTGAAAATGG + Intronic
935532195 2:104247929-104247951 AAGTGTGACCTAATTTTAGTAGG + Intergenic
935741771 2:106155069-106155091 TTGTGTGAACTCATTACAGTGGG + Intronic
938111682 2:128571810-128571832 GTTTGTGCCCTAATTGAAGAGGG - Intergenic
942763256 2:179425308-179425330 TAGTGGGACCTATTTGAAATAGG + Intergenic
948469000 2:238165537-238165559 TTGTGTGTCGTAGGTGAAGTTGG + Intronic
1171378810 20:24716464-24716486 TTTTCTGACCTAATTGACCTGGG + Intergenic
1175365125 20:58448299-58448321 TTCTGTGGCCTAATTGGATTTGG + Exonic
959611709 3:108302538-108302560 TTGTTTTCCCTAATTCAAGTTGG + Exonic
970089733 4:12391415-12391437 TTGTGTGACCTCATGGAACTAGG + Intergenic
973269458 4:48246926-48246948 TTGCGTGACATTATTGAAGAAGG + Intronic
976347689 4:84024306-84024328 TTGTGTGACCTTGTTAATGTAGG + Intergenic
978228119 4:106363525-106363547 TTCTGTGACCTACTGTAAGTAGG + Intergenic
979368393 4:119852663-119852685 AAGTGGGACCTAATTAAAGTAGG + Intergenic
981054924 4:140350858-140350880 TTATGTGAGCTCCTTGAAGTGGG - Intronic
982637430 4:157914733-157914755 TTGTGGGAATTAAATGAAGTAGG - Intergenic
988049349 5:26004754-26004776 TTGTGTGAACTAATAAAACTTGG + Intergenic
990273856 5:54174861-54174883 TTGTCTGTCCTAATTGAATGTGG - Intronic
990509288 5:56475729-56475751 TTGTTTGACCTAATATATGTAGG - Intronic
990985477 5:61637659-61637681 TTGTGTGACCTAACTGGACAGGG - Intergenic
992094795 5:73353062-73353084 ATATATGACCTAATAGAAGTGGG - Intergenic
992713518 5:79485713-79485735 AAGAGGGACCTAATTGAAGTTGG + Intronic
993153764 5:84195473-84195495 TTGTGTGACCTAATTGAAGTAGG + Intronic
1004740138 6:18451950-18451972 TTGAGAGCCCTAATTGAGGTGGG + Intronic
1010537968 6:77054364-77054386 TTTTTTGAACTCATTGAAGTGGG + Intergenic
1014296412 6:119623833-119623855 TTCTGTGACCTAAAGGAAGAAGG + Intergenic
1018229905 6:161665593-161665615 TTGGGTGACCTATTAGAAGATGG - Intronic
1023126759 7:36961969-36961991 TTGTGTGACTTAATTAAATTAGG + Intronic
1023287662 7:38635738-38635760 TTGCAGGACCTAATTGAAATTGG + Intergenic
1025088871 7:56046006-56046028 TTGTGTTACCCCATGGAAGTTGG - Intronic
1025900980 7:65744619-65744641 TTGTGTTACCCCATGGAAGTTGG - Intergenic
1033706155 7:143886493-143886515 GTTTGTGACCTAGTTGAAGTGGG - Intronic
1040569598 8:48596113-48596135 TTTTGTCACCTGAATGAAGTAGG + Intergenic
1040682685 8:49832586-49832608 TAGAGTTACCTAATTGAGGTAGG + Intergenic
1041879957 8:62737796-62737818 GTTTGTGCCCTAATTGAAGGGGG - Intronic
1042403460 8:68376422-68376444 ATGTTTGGCCTAATTGAAATGGG + Intronic
1049612919 8:143563767-143563789 TTGTGTGCCCTGACAGAAGTGGG - Intergenic
1051228572 9:14929185-14929207 TTGTGTGACCTTGGAGAAGTGGG + Intergenic
1051449802 9:17182581-17182603 TTTGGTGAGTTAATTGAAGTAGG + Intronic
1055396800 9:75884268-75884290 TTCTTTGACCTGTTTGAAGTTGG - Intergenic
1055699243 9:78924315-78924337 TGGTGTGACCTATTTAAAGAGGG + Intergenic
1058111082 9:101030819-101030841 TTTTGTGACTTCTTTGAAGTGGG + Intronic
1185909095 X:3965830-3965852 TTGTGTGACCTAATTGTTCCGGG + Intergenic
1186422250 X:9435639-9435661 TTGTGTGACTTCAATGAAGCGGG + Intergenic
1187344798 X:18453152-18453174 TTGTGTGACCAAAAAGAAGAGGG - Intronic
1197521915 X:127509323-127509345 ATGTGTGACCTTATGGAACTTGG - Intergenic