ID: 993154195

View in Genome Browser
Species Human (GRCh38)
Location 5:84201292-84201314
Sequence ACTGAAAACATTCATAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993154195_993154197 -4 Left 993154195 5:84201292-84201314 CCTTATCTATGAATGTTTTCAGT 0: 1
1: 0
2: 0
3: 21
4: 287
Right 993154197 5:84201311-84201333 CAGTAGGATGCCTCTAGTTTAGG No data
993154195_993154199 7 Left 993154195 5:84201292-84201314 CCTTATCTATGAATGTTTTCAGT 0: 1
1: 0
2: 0
3: 21
4: 287
Right 993154199 5:84201322-84201344 CTCTAGTTTAGGATTGTTTCTGG 0: 1
1: 0
2: 1
3: 6
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993154195 Original CRISPR ACTGAAAACATTCATAGATA AGG (reversed) Intronic
902274855 1:15331778-15331800 ACTGATACCATTCATATCTATGG - Intronic
907062157 1:51439224-51439246 ACTGAAACCTTTCAGAGGTAGGG - Intronic
908331553 1:63075581-63075603 ACGGAAAAGAATCATAGACAGGG + Intergenic
909197610 1:72647924-72647946 ATGGAAAACATTCCTAGAAAAGG + Intergenic
909543294 1:76815136-76815158 ATTGAGAAAATTCATAGATTAGG + Intergenic
909724188 1:78813997-78814019 ATTAAAATCATTCATAGACATGG + Intergenic
909901591 1:81143587-81143609 GCAGAAAACATTCATAGTTCAGG + Intergenic
910493903 1:87804399-87804421 ATTTAACACATTTATAGATAAGG - Intergenic
910586050 1:88880579-88880601 GCTGAACACATTCACATATATGG + Intronic
911975068 1:104482016-104482038 ACTGAAAAAATTCTGAGTTATGG + Intergenic
916923716 1:169495668-169495690 ATCAGAAACATTCATAGATATGG - Intergenic
917467911 1:175299563-175299585 AAAGAAAACATTCAAAGAAAAGG - Intergenic
918107734 1:181427999-181428021 ACTGGGAACATCCATTGATAGGG - Intronic
918216425 1:182395321-182395343 ATTGAAATCATTCATACACAGGG - Intergenic
919240775 1:194913994-194914016 ACTTAAAACAGTGAAAGATATGG + Intergenic
919396870 1:197061007-197061029 ACAGAAAACATTCAAAGTGAAGG - Exonic
920777321 1:208952443-208952465 ACTGAAAAAAAGCATAGACAAGG + Intergenic
921237109 1:213144420-213144442 TGTGAAAAAATTCATAGAAATGG + Intronic
923224446 1:231926118-231926140 GTTGAAAATATTCATAGAAATGG - Intronic
924861685 1:247930701-247930723 AATGAAGACATTTTTAGATATGG + Intergenic
1063818492 10:9806574-9806596 ACAGAAAATATTAATATATAGGG + Intergenic
1063825308 10:9890831-9890853 ATTAAAAAAATTCATTGATACGG - Intergenic
1067280597 10:44869324-44869346 GCTGTAAACATTCATAAAGAAGG + Intergenic
1069968884 10:72147632-72147654 ACTGAAAACCTTCTTAGTTCAGG + Intronic
1070232814 10:74588448-74588470 ACTGAAAACATTCATAGGGTAGG - Intronic
1071046290 10:81382991-81383013 ACTGAGAACATTTATATGTATGG - Intergenic
1071090869 10:81916651-81916673 ACTGAAAAAATACATAGTGAAGG + Intronic
1071591676 10:86880467-86880489 ACTGTAAGCTTTAATAGATATGG + Intronic
1072288259 10:93937910-93937932 ACTAAAAACAAACATAGAAAGGG + Intronic
1072495187 10:95950042-95950064 CCTGAAAACATTCATAAAGTTGG - Exonic
1072554651 10:96505564-96505586 AGTAACCACATTCATAGATAAGG + Intronic
1073237021 10:102025528-102025550 ACTGCAAACATTCATTAATTTGG - Intronic
1076080445 10:127575810-127575832 AGTGAGAACATTCATAAATGTGG - Intergenic
1078499266 11:11853700-11853722 AATTAAAACATTCATATACATGG - Intronic
1078728887 11:13957999-13958021 ACTGAATACATACGTACATACGG - Intergenic
1079416438 11:20241515-20241537 AATGAAAACATTTTTAGAAAAGG - Intergenic
1081429380 11:42959383-42959405 AATGAATACCTTAATAGATATGG - Intergenic
1082244817 11:49910034-49910056 ACTGGATACATACATATATATGG + Intergenic
1083061682 11:59879647-59879669 ACTCAAAACATTCACAGCTGTGG - Intergenic
1084104684 11:66973684-66973706 ACTGAAAAAATACAAAGATTAGG - Intergenic
1085857266 11:80189005-80189027 AATGAAAATATTCTAAGATATGG + Intergenic
1086146975 11:83562693-83562715 ATTGAAAAAATACATAGCTAAGG + Intronic
1086217140 11:84397113-84397135 AATGAAAAAATTTAAAGATAAGG + Intronic
1086338862 11:85826953-85826975 ACTGAAAACACTCAGGGTTATGG - Intergenic
1087765675 11:102150780-102150802 AGTGAAAACATACATACAAATGG + Intronic
1088290013 11:108225792-108225814 ACTGAGAATATTCAAAGACAGGG + Intronic
1090521211 11:127481388-127481410 ACAGAAAACACTCAGAGAAAGGG - Intergenic
1090931632 11:131302794-131302816 ACTGAAAAACTTAATAGATGAGG + Intergenic
1093382064 12:18505068-18505090 AGTGAAAACATTCATCTATTAGG + Intronic
1093943221 12:25078465-25078487 ACTGAAATCATTCAGACATATGG - Intronic
1095308008 12:40661211-40661233 ACTAAGAACATTCATATTTAAGG - Intergenic
1096967769 12:55642078-55642100 ACTGAAAAGATAGAGAGATACGG + Intergenic
1097298415 12:57991991-57992013 ACTGTAAACCTTCAGAGATTGGG + Intergenic
1097769228 12:63561731-63561753 ACTATAAACATTCATGGACAAGG + Intronic
1099172657 12:79383422-79383444 CATGAAAATATTCATAGTTAGGG - Intronic
1099305729 12:80953005-80953027 AGTAAAAACAAACATAGATATGG - Intronic
1099916845 12:88905343-88905365 AATGAAAACATTCCTAGTCAGGG + Intergenic
1100969652 12:100054301-100054323 ACAGCAAACATACATATATATGG + Intronic
1104324313 12:127781918-127781940 ACTAAAAACATACATAAAAACGG + Intergenic
1107569161 13:41638333-41638355 AAATAAAACAGTCATAGATATGG - Intronic
1108105912 13:47008967-47008989 ACTTAAAGTATTCATAGACAGGG + Intergenic
1109773820 13:67013490-67013512 ATTGAAAATAATCAGAGATATGG - Intronic
1114986242 14:28231939-28231961 ACCAAAAACATTAATTGATATGG - Intergenic
1115862609 14:37705441-37705463 ACTGTTAACATTCTTAAATATGG + Intronic
1116205247 14:41857013-41857035 ACTTAAAAGGTTCTTAGATAAGG - Intronic
1116442899 14:44975148-44975170 AATGAAAACATACACAGAAAGGG - Intronic
1118001300 14:61526209-61526231 ACTGAAAACAGTCACTTATATGG + Intronic
1118520541 14:66578413-66578435 ACAGAAAACATTCATAAACTAGG + Intronic
1119019075 14:71091031-71091053 ACTGACAACATTTATAAACAGGG + Intronic
1119932202 14:78558474-78558496 AATGAAAATATTCATAGAAAGGG - Intronic
1120034451 14:79680733-79680755 AATGAAAAAATTCATTGATGGGG + Intronic
1120261722 14:82193783-82193805 AATGAAAACAATAAAAGATAAGG + Intergenic
1121566204 14:94911398-94911420 ACTAAAGACATTTTTAGATATGG + Intergenic
1123053306 14:105558028-105558050 ACTGAAAACCGTAATAGATGAGG - Intergenic
1202889689 14_KI270722v1_random:144359-144381 GGGGAAAACATTCATTGATATGG - Intergenic
1123780277 15:23620196-23620218 CCAGAAAGCATTCATACATATGG - Intronic
1126190159 15:45870606-45870628 ACAGAAAACACTCACAGATGTGG + Intergenic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1127881716 15:63163899-63163921 ACTTAAAAGGTTCCTAGATATGG - Intergenic
1127985479 15:64067205-64067227 ACTGAAGACTTTCTTAGATATGG - Intronic
1129179493 15:73864400-73864422 ACTTAATACATTCGTTGATATGG - Intergenic
1129985446 15:79916139-79916161 ACTTAAAACTTTCCTAAATAGGG + Intronic
1129986041 15:79920453-79920475 ACTTAAAACTTTCCTATATAGGG + Intronic
1130663254 15:85848355-85848377 TGTGGAAACATTCATAGATCTGG - Intergenic
1130783625 15:87072039-87072061 AGAGAAAACATTCATATATTAGG + Intergenic
1131248077 15:90813347-90813369 ACTGAAAACAAGCATGGAAATGG - Intronic
1132068811 15:98757111-98757133 ACTGAAAACATACATGAATTTGG - Intronic
1133124022 16:3633155-3633177 ACAGAAAACAGTAATAAATATGG - Intronic
1133597382 16:7305478-7305500 ACTGTAAACCTTCATAGAATAGG - Intronic
1139089106 16:63622114-63622136 ACTGAAGACATCCCTACATAGGG + Intergenic
1141952719 16:87349024-87349046 ACAGGAAACATTCATACATGGGG + Intronic
1142791257 17:2268045-2268067 ACTTAAAAAATACATAAATAAGG - Intronic
1147223952 17:38960279-38960301 AGTGAAAACAATAATAGATCAGG + Intronic
1149975535 17:61262356-61262378 ACATAACATATTCATAGATAGGG + Intronic
1154079296 18:11238816-11238838 ACTGAAAATCTTCATATATTTGG + Intergenic
1154436464 18:14346324-14346346 CCTCAAAACATGCATATATAAGG - Intergenic
1155068760 18:22294009-22294031 ACTGAAACCCAACATAGATAAGG - Intergenic
1155803515 18:30138380-30138402 ACTGAAAACATTCAGAAAAGAGG - Intergenic
1156406782 18:36790387-36790409 ACTGAAAGCATCCAGAGAGATGG + Intronic
1156647291 18:39180273-39180295 AGTGAGAAGATTCATAGAAAAGG + Intergenic
1157231321 18:45919202-45919224 ACTTAAAACAATCTTAGGTATGG - Intronic
1158057353 18:53297423-53297445 ACTGAAATTATTCATTGATTCGG + Intronic
1158305659 18:56102720-56102742 CCTGAAAACATTCTTGGAAAAGG - Intergenic
1158797851 18:60870231-60870253 AGTGAAAAAATTGATAGGTAAGG - Intergenic
1158843896 18:61420271-61420293 AATGAAGACATTCATAAATTAGG - Intronic
1160335265 18:78033007-78033029 AGGGAAAACAGTCGTAGATAAGG + Intergenic
1160449419 18:78952071-78952093 ACTGAAACCATCCATAAAAATGG - Intergenic
1161735214 19:5988021-5988043 ACTGAAAGCAGTCAAAGATCAGG - Intergenic
1167023766 19:46899187-46899209 ACTGATAACATTCAGAGAGGTGG + Intergenic
1202665091 1_KI270708v1_random:111126-111148 GGGGAAAACATTCATTGATATGG - Intergenic
925471837 2:4171087-4171109 CCTGGAAACATTCAGAGAAAAGG - Intergenic
925638265 2:5963325-5963347 CCTTAAAACAATAATAGATAGGG - Intergenic
926842037 2:17091490-17091512 ACTCTAAACATTCAAAGATTTGG + Intergenic
928424915 2:31169821-31169843 ACTGAAAATATCAATATATAAGG - Intergenic
930483488 2:51981144-51981166 ACTGAAAACAGTCTTAAAAAAGG + Intergenic
930512466 2:52362273-52362295 ACTTAAAAGAATCATAGCTAAGG - Intergenic
932383178 2:71304754-71304776 ACTGAAAAAATGTATACATACGG - Intronic
932850551 2:75180392-75180414 ACTGCAAACACTCATAGAAAAGG - Intronic
933225842 2:79748775-79748797 ACTGAAAACTTTTAGAGATCTGG - Intronic
933396370 2:81736654-81736676 TCTGAACACATTAATATATAAGG - Intergenic
933460124 2:82572548-82572570 TCTGAAGACATTTATTGATATGG + Intergenic
933607336 2:84397166-84397188 ACTGAAAAGTTTCATGGAGAAGG + Intergenic
937014692 2:118594457-118594479 AATGAGAACAATTATAGATAAGG - Intergenic
937381932 2:121386112-121386134 ACTGGAAACCTTCAGTGATAAGG + Intronic
939705683 2:145449623-145449645 TCTGTAAACAATTATAGATAGGG - Intergenic
940376439 2:152964025-152964047 ATGGAAACCATTCCTAGATAAGG - Intergenic
940416309 2:153425658-153425680 ACTGAAAACTTACACAGAGATGG - Intergenic
940568701 2:155403296-155403318 ACTGAAAACATCCAGAAATGGGG + Intergenic
940681065 2:156785906-156785928 ACTGAAATCCTGCATAGTTAAGG - Intergenic
941524796 2:166593585-166593607 AATGAATACAGTCATAGAAATGG - Intergenic
942519069 2:176783857-176783879 ACAGAGAAAATTCACAGATAGGG + Intergenic
943593181 2:189823186-189823208 ACTGAAAAAACTCACAGATTTGG + Intronic
944179276 2:196870201-196870223 TTTGAAAACATTCATTTATATGG + Intronic
944266846 2:197736957-197736979 AATGAAATCCTTCATAGAGAGGG - Intronic
944366614 2:198928413-198928435 AAGGAAAACATTCATAGACAAGG + Intergenic
944456311 2:199898408-199898430 GCTGAATTCATTCATAAATAGGG + Intergenic
945104418 2:206296159-206296181 ACTGAAACCAACCACAGATAAGG - Intronic
945632076 2:212291008-212291030 ATAGAAAACATACATAGGTATGG - Intronic
945729272 2:213513374-213513396 CCTGAGAACATGCATAGAAATGG - Intronic
946525261 2:220511600-220511622 ATTGACAACATTAATAGAAAGGG + Intergenic
946542884 2:220705078-220705100 ACTGTAAAAATTTATAGATGTGG - Intergenic
946837409 2:223786208-223786230 AGCGAAAACAATCATAGGTAAGG + Intronic
946909870 2:224449441-224449463 GCTGAAAACAAACATAAATATGG + Intergenic
947333825 2:229059098-229059120 ATAGAAAACATTCAAGGATAGGG - Intronic
1169462606 20:5809297-5809319 CTTGACAGCATTCATAGATATGG + Intronic
1170096014 20:12646828-12646850 ACTGATAACATGTATTGATAGGG + Intergenic
1170338053 20:15293317-15293339 ACTTAATTCATTCAAAGATATGG - Intronic
1170449836 20:16471259-16471281 ACTGAAAAAATTCCTTGATTTGG + Intronic
1170461671 20:16582700-16582722 ACTACAAACATTCACATATAGGG + Intergenic
1170734294 20:19000699-19000721 ACTGAAAACATTCAGACATTTGG + Intergenic
1173911016 20:46670952-46670974 ACTGAAAACATAGACACATAAGG - Intronic
1174713520 20:52732092-52732114 ACTGAAAACATAAGTAGCTATGG - Intergenic
1176914914 21:14613575-14613597 AGCAAAAACATGCATAGATAAGG + Intronic
1177029569 21:15966141-15966163 ACAGGATAGATTCATAGATAAGG + Intergenic
1177357163 21:20023341-20023363 AATGAAAATATAAATAGATATGG + Intergenic
1178248796 21:30981308-30981330 AATGAAAACATCCAAAGAGATGG + Intergenic
1178615651 21:34130539-34130561 TCTGAAAACACTCAGAGAAATGG - Intronic
1179335974 21:40454388-40454410 ACAGAAAACTTTCACAGATATGG - Intronic
1183128206 22:35805664-35805686 ACTGTAAACATTCATATGCAGGG - Intronic
1183142485 22:35956006-35956028 TATGAAAAAATTCATTGATAAGG - Intronic
949402291 3:3678513-3678535 ACTGAAAACACTCATGAATGAGG - Intergenic
949487948 3:4558602-4558624 AATGAAAACATACATAGGCAAGG + Intronic
950805139 3:15595510-15595532 GCTTAAAAAATACATAGATAAGG + Intronic
951257148 3:20463127-20463149 CCTGAAAACATAGATATATAGGG - Intergenic
951723542 3:25728224-25728246 ACCAAAAACATACAGAGATAAGG - Intronic
954343621 3:49976843-49976865 ACTGAAGACATTGATACACATGG + Intronic
956924014 3:73962859-73962881 ACTGGGAACATTAATAGGTAGGG + Intergenic
957090826 3:75728452-75728474 GGGGAAAACATTCATTGATACGG + Intronic
957283336 3:78182668-78182690 ACTGAAAAGATTGATAGATTAGG + Intergenic
957704450 3:83761497-83761519 ACTGAAAAAATTTCTAGAAATGG + Intergenic
957829256 3:85494600-85494622 ACTGAAAACAATATTAGACATGG + Intronic
959192171 3:103128361-103128383 AGAGAAAACATTTATTGATATGG - Intergenic
962986525 3:140541246-140541268 ACTTAAAACTTTAATAGATGAGG - Intronic
963971595 3:151436142-151436164 ACTGAAAATTTTCATTGATGGGG - Exonic
964069725 3:152616914-152616936 AGTGGAAACATTCATCAATAGGG + Intergenic
964985773 3:162736195-162736217 AGTGAAAGGATTCATGGATATGG + Intergenic
965079722 3:164020852-164020874 ACAGAAATCATCCATAGATTTGG - Intergenic
965329761 3:167357299-167357321 AATGAAGAAAGTCATAGATAAGG + Intronic
965501597 3:169462670-169462692 ACTGGAAACAGTCTTGGATAGGG + Intronic
967653756 3:192019958-192019980 ATTCAAAACATTCATTTATATGG - Intergenic
968386267 4:141550-141572 ACTGAAAACATTCAGAAAGGAGG + Intronic
968526986 4:1064737-1064759 AATGAAAACAGTTATAGAGATGG - Intronic
969367322 4:6704474-6704496 ACTGTAAACAAACATAGACATGG + Intergenic
970693450 4:18646247-18646269 ACTGAAAACATTCTTCCATTTGG - Intergenic
971335105 4:25715558-25715580 AGGGAAAACATTTTTAGATATGG - Intergenic
971415487 4:26423848-26423870 ACAGAATACATGCATAGAAAAGG - Intronic
971808995 4:31399017-31399039 ACTGAAGACATCCATATTTAAGG + Intergenic
972527327 4:39928137-39928159 AGTGAAAACCTTTATGGATATGG - Exonic
974149930 4:57993328-57993350 AATGGAAACTTTCATGGATAAGG + Intergenic
974194520 4:58555097-58555119 ACTGAAAAGTTTCACAGATTTGG + Intergenic
974849627 4:67388788-67388810 ACTAAAAACATTGAAACATAAGG + Intergenic
975603477 4:76127833-76127855 ACTGAAATCATTCATATCTTTGG - Intronic
976027198 4:80703421-80703443 ACTGAAAATATTAAGAAATAGGG + Intronic
976242417 4:82972310-82972332 ACTTTAAAAATTCATAGATGGGG - Intronic
976751053 4:88451716-88451738 ACGGAAACCATTCCTAGTTAAGG + Intergenic
978363494 4:107956311-107956333 AATGAAAAAATTCACAAATATGG + Intergenic
978816141 4:112908050-112908072 GCTGAAAACATCCATAAAGATGG + Intronic
978835894 4:113149315-113149337 ACTGATATGCTTCATAGATAAGG - Intronic
978994936 4:115139297-115139319 GCTTAAACAATTCATAGATATGG - Intergenic
979611696 4:122696126-122696148 ACAGAAAGAATTCAGAGATAGGG - Intergenic
979618433 4:122770941-122770963 AATGAAAAGATTCATGGATTTGG + Intergenic
979741544 4:124157338-124157360 AATGAAAACATTCATTTATAGGG - Intergenic
980761706 4:137242456-137242478 AATGAAAATATTGATAAATATGG - Intergenic
980883834 4:138740429-138740451 ACTGAGAATATTCATATATTGGG - Intergenic
980956189 4:139431398-139431420 ACTGAAAACCTTCTAAGATCTGG - Intergenic
982177042 4:152715627-152715649 ACTTAAAACAGTTTTAGATAAGG + Intronic
983573890 4:169239480-169239502 AATAAAAACATACATACATATGG - Intronic
985038601 4:185866077-185866099 ACAGAAAACACTCTTAAATATGG - Intronic
986897799 5:12392011-12392033 ACTGAAAACAGGCATATTTAAGG - Intergenic
987867065 5:23556778-23556800 ACCACAAACATTCATATATATGG - Intergenic
988067590 5:26241257-26241279 CCTGAAAATATTCTTAAATATGG + Intergenic
988725763 5:33924922-33924944 ACTGAGAACATTTATGGAAATGG - Intergenic
989645358 5:43625965-43625987 ACTAAAAATATTTATAGGTAAGG - Intronic
989954860 5:50346274-50346296 ACTGTACACATACACAGATAGGG - Intergenic
990672315 5:58146650-58146672 ACTTAACACATTAATAGAGAAGG - Intergenic
991194394 5:63915645-63915667 ACTGAATACAGTAATATATATGG - Intergenic
991705186 5:69350727-69350749 ACTGAAAACATACATCCACATGG + Intergenic
992888415 5:81181966-81181988 GGTGAAAAAATTCATAGATGGGG + Intronic
993125073 5:83824058-83824080 AATGAAAAGATTCCTAGAAAAGG + Intergenic
993154195 5:84201292-84201314 ACTGAAAACATTCATAGATAAGG - Intronic
995044595 5:107631223-107631245 ACTAAAAACATTGTTACATAGGG + Intronic
995381775 5:111543331-111543353 ACAGAGGACATACATAGATAGGG + Intergenic
995453985 5:112332739-112332761 ACTGAAAATATGCACAGATATGG + Intronic
995496627 5:112751621-112751643 ACAGAAATCATTCATTTATAGGG - Intronic
995879092 5:116823519-116823541 ACTGAAAATATTCACACTTAGGG + Intergenic
996196827 5:120617870-120617892 AGTGAAAACATGCATAGTCAAGG + Intronic
996364307 5:122684462-122684484 ACTCAAAACATTTATAAAAAGGG + Intergenic
996503242 5:124240031-124240053 GCTGAAGACATGTATAGATAGGG + Intergenic
997191756 5:131944316-131944338 ACTGGAAACATTCATTACTAAGG - Intronic
997925588 5:138028287-138028309 ACTGAAAACATGCACAGGCAAGG + Intronic
999334968 5:150707545-150707567 ACTGAAAAATTGCATAGTTAAGG + Intergenic
999392524 5:151204435-151204457 ACTAAACACGTTCAGAGATAGGG + Intronic
1000459068 5:161490062-161490084 GCTGAAAACATTTATATGTAGGG - Intronic
1000559131 5:162764068-162764090 ACTATGAACATTCATACATAAGG - Intergenic
1000852025 5:166351849-166351871 ACTTAAAAAGTTCATAGAAAGGG - Intergenic
1005720085 6:28592957-28592979 ACTGAAAAAATTAATAAATAAGG + Intronic
1007063645 6:38967078-38967100 ATTGAAAACATTGATAAATATGG + Intronic
1007068363 6:39015894-39015916 ACAGAAAGCAGTCATGGATAAGG - Intronic
1009313399 6:62186899-62186921 ACTGAATACATTCAAAGAAAGGG - Intronic
1009925150 6:70112081-70112103 ACTCAAAGCATTCATAGGTGTGG + Intronic
1010106690 6:72178355-72178377 ACTGAAAATATTCAGATAAATGG - Intronic
1010867142 6:80991133-80991155 ACAGCAAACATGCAAAGATAAGG - Intergenic
1010950734 6:82034152-82034174 AGGGAAAACATTCTTAGATGAGG + Intergenic
1011585366 6:88919046-88919068 CATCAAAACATTTATAGATAGGG + Intronic
1011727644 6:90226560-90226582 ACTGAGAACATTTAAAAATAAGG + Intronic
1012610078 6:101206823-101206845 AGTGAAAACATTCATACTAATGG - Intergenic
1012777137 6:103511513-103511535 ACAGGAAACATTCCTAGAGAAGG - Intergenic
1013969010 6:115993471-115993493 AGTGAAAACATTTATACCTAGGG - Intronic
1015202128 6:130594639-130594661 AATCAAAACAATCAAAGATATGG - Intergenic
1015680991 6:135808247-135808269 ACCGAAATCACTCATAGATAAGG - Intergenic
1015947008 6:138513186-138513208 ACAGGTAACATTCATAGAAATGG + Intronic
1018353641 6:162989635-162989657 ATTGAAAATATTCATAAAAATGG - Intronic
1022367682 7:29741058-29741080 ACTATAAACATTCATGGACAAGG - Intergenic
1022928499 7:35082809-35082831 ACTATAAACATTCATGGACAAGG + Intergenic
1023118436 7:36885282-36885304 ATTGGAAAAATTTATAGATACGG + Intronic
1026251840 7:68678111-68678133 ACAGAATTCATTCATAAATAGGG + Intergenic
1026696957 7:72603436-72603458 ACTGAATACATTAATAAATGAGG + Intronic
1026975624 7:74495951-74495973 AGTGAAAACCTTCACAGAGAAGG - Intronic
1029043311 7:97600191-97600213 ACTTAAAAAATGCACAGATAAGG + Intergenic
1029847632 7:103429046-103429068 ACTGGAAACATTTAAAGATAAGG - Intronic
1030407349 7:109130791-109130813 ACTGAAACTTTTCATAGGTAAGG + Intergenic
1031165939 7:118226971-118226993 ACTTAAAGTATTTATAGATAGGG + Intronic
1032545984 7:132743042-132743064 AAAGAAAACATTCAGAGATGTGG - Intergenic
1035414139 7:158668390-158668412 ACAGAAAACAGTAATAGGTAAGG - Intronic
1035694907 8:1588494-1588516 AATGAAAAAATTCATAAATTAGG - Intronic
1036539370 8:9689300-9689322 ACTGAAAACATTCTTTTAAAAGG - Intronic
1037323490 8:17665815-17665837 GCTGAAAAGATTCCAAGATAAGG + Intronic
1037844921 8:22274875-22274897 ACTAAAAACATCCATTCATAGGG - Intergenic
1039251467 8:35669711-35669733 ACTGAAAACATTTAAAGAGCTGG - Intronic
1041795256 8:61740372-61740394 ACTGAAATAATACATAAATATGG + Intergenic
1043248755 8:78041219-78041241 ACTGAGATCATTCAAACATATGG + Intergenic
1043293903 8:78640192-78640214 ACTGTAAACATTCATATACACGG + Intergenic
1043298066 8:78691764-78691786 AATAAAAATATCCATAGATATGG - Intronic
1043711571 8:83425255-83425277 ATTGAAAAGATTTGTAGATATGG + Intergenic
1044640973 8:94381285-94381307 ACAGAAAAGATCCACAGATAGGG + Intronic
1044994596 8:97827442-97827464 GATGAAGAGATTCATAGATATGG - Intronic
1045767791 8:105696015-105696037 ACTGACAAGATTCATAGTTATGG - Intronic
1046163655 8:110399956-110399978 ACTTAAAAAATTAATAGATAAGG + Intergenic
1046382674 8:113471694-113471716 ATGGAAACCATCCATAGATAAGG - Intergenic
1046403251 8:113735960-113735982 ACTGAAAAAAATAATAGACAAGG + Intergenic
1047741619 8:127811274-127811296 ACTGAAAACATTTAAAAATCAGG - Intergenic
1048297666 8:133226565-133226587 ACTGAAAACGTACATGGAAAAGG + Intronic
1048303451 8:133267530-133267552 ACTGGAAAAATCCATAGATGAGG + Intronic
1048846260 8:138606054-138606076 AATGAAATCATTCATATAAAGGG - Intronic
1050560446 9:6829536-6829558 AGTCAACACATTGATAGATAAGG + Intronic
1051257056 9:15224605-15224627 ACTGAAAGCATTAATAAATAAGG - Intronic
1051525961 9:18044597-18044619 TGTGAAAAGATTCAAAGATAAGG + Intergenic
1051569395 9:18538570-18538592 AGTGAAAAGATTCATAGCAAGGG + Intronic
1051866084 9:21684562-21684584 ACTGTAGACATTCTTAGAGAGGG - Intergenic
1055475090 9:76655169-76655191 ACTGAAAACATTGGCAGATAAGG + Intronic
1055950570 9:81726037-81726059 AAAGAAAAGATACATAGATATGG - Intergenic
1056622973 9:88229753-88229775 ATTAAAAACATTAATATATAAGG - Intergenic
1056870800 9:90276081-90276103 AATGAAAAAATTCAAAAATAGGG - Intergenic
1058213829 9:102206536-102206558 AGGGAAAATATTCAAAGATACGG + Intergenic
1059856519 9:118404045-118404067 GCTTAATACATTCATAGAAAGGG + Intergenic
1059861550 9:118468840-118468862 ACTTAAAACATTTTTAGAAACGG + Intergenic
1203486791 Un_GL000224v1:63538-63560 GGGGAAAACATTCATTGATATGG - Intergenic
1203499413 Un_KI270741v1:5438-5460 GGGGAAAACATTCATTGATATGG - Intergenic
1188609198 X:32075279-32075301 ACTGAAAAAAATCCTACATATGG - Intronic
1191777423 X:64830934-64830956 ACTGAGAACATTCAAAGGTGAGG + Intergenic
1192281221 X:69688285-69688307 AGTGAAAACTTTCATAGAAGAGG + Intronic
1193270245 X:79520773-79520795 ACTCAAAAAATTCAAAGACAAGG + Intergenic
1193756785 X:85418673-85418695 ACTGAGCACATTCACAGCTATGG - Intergenic
1194479720 X:94406012-94406034 GCTGAAATCAATGATAGATACGG + Intergenic
1197508101 X:127333890-127333912 AATGATGACCTTCATAGATAAGG - Intergenic
1197561444 X:128026570-128026592 ACAGAGAAAATTCATAGATCTGG + Intergenic
1197740405 X:129888139-129888161 ACTGAATAAGTTAATAGATATGG + Intergenic
1197793300 X:130276941-130276963 ACAGAAAAAATTCACAGAAATGG + Intergenic
1201535613 Y:15045136-15045158 ACTGAAACCATTCTCAGAAAAGG + Intergenic