ID: 993159931

View in Genome Browser
Species Human (GRCh38)
Location 5:84277163-84277185
Sequence TTCAACATATGAATCTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6599
Summary {0: 4, 1: 201, 2: 1008, 3: 2226, 4: 3160}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993159931_993159944 13 Left 993159931 5:84277163-84277185 CCCCCCAAGATTCATATGTTGAA 0: 4
1: 201
2: 1008
3: 2226
4: 3160
Right 993159944 5:84277199-84277221 AGGCGATGGTATTAAGAGGTGGG 0: 1
1: 35
2: 329
3: 1175
4: 2281
993159931_993159937 -1 Left 993159931 5:84277163-84277185 CCCCCCAAGATTCATATGTTGAA 0: 4
1: 201
2: 1008
3: 2226
4: 3160
Right 993159937 5:84277185-84277207 AATTTTAACCCCCAAGGCGATGG 0: 1
1: 2
2: 58
3: 339
4: 1690
993159931_993159945 14 Left 993159931 5:84277163-84277185 CCCCCCAAGATTCATATGTTGAA 0: 4
1: 201
2: 1008
3: 2226
4: 3160
Right 993159945 5:84277200-84277222 GGCGATGGTATTAAGAGGTGGGG No data
993159931_993159946 22 Left 993159931 5:84277163-84277185 CCCCCCAAGATTCATATGTTGAA 0: 4
1: 201
2: 1008
3: 2226
4: 3160
Right 993159946 5:84277208-84277230 TATTAAGAGGTGGGGCTTTTAGG 0: 17
1: 238
2: 943
3: 2010
4: 3170
993159931_993159941 9 Left 993159931 5:84277163-84277185 CCCCCCAAGATTCATATGTTGAA 0: 4
1: 201
2: 1008
3: 2226
4: 3160
Right 993159941 5:84277195-84277217 CCCAAGGCGATGGTATTAAGAGG 0: 1
1: 34
2: 261
3: 880
4: 2085
993159931_993159936 -7 Left 993159931 5:84277163-84277185 CCCCCCAAGATTCATATGTTGAA 0: 4
1: 201
2: 1008
3: 2226
4: 3160
Right 993159936 5:84277179-84277201 TGTTGAAATTTTAACCCCCAAGG 0: 5
1: 54
2: 262
3: 573
4: 900
993159931_993159943 12 Left 993159931 5:84277163-84277185 CCCCCCAAGATTCATATGTTGAA 0: 4
1: 201
2: 1008
3: 2226
4: 3160
Right 993159943 5:84277198-84277220 AAGGCGATGGTATTAAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993159931 Original CRISPR TTCAACATATGAATCTTGGG GGG (reversed) Intronic
Too many off-targets to display for this crispr