ID: 993159935

View in Genome Browser
Species Human (GRCh38)
Location 5:84277167-84277189
Sequence AAATTTCAACATATGAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5112
Summary {0: 1, 1: 30, 2: 341, 3: 1428, 4: 3312}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993159935_993159944 9 Left 993159935 5:84277167-84277189 CCAAGATTCATATGTTGAAATTT 0: 1
1: 30
2: 341
3: 1428
4: 3312
Right 993159944 5:84277199-84277221 AGGCGATGGTATTAAGAGGTGGG 0: 1
1: 35
2: 329
3: 1175
4: 2281
993159935_993159946 18 Left 993159935 5:84277167-84277189 CCAAGATTCATATGTTGAAATTT 0: 1
1: 30
2: 341
3: 1428
4: 3312
Right 993159946 5:84277208-84277230 TATTAAGAGGTGGGGCTTTTAGG 0: 17
1: 238
2: 943
3: 2010
4: 3170
993159935_993159937 -5 Left 993159935 5:84277167-84277189 CCAAGATTCATATGTTGAAATTT 0: 1
1: 30
2: 341
3: 1428
4: 3312
Right 993159937 5:84277185-84277207 AATTTTAACCCCCAAGGCGATGG 0: 1
1: 2
2: 58
3: 339
4: 1690
993159935_993159943 8 Left 993159935 5:84277167-84277189 CCAAGATTCATATGTTGAAATTT 0: 1
1: 30
2: 341
3: 1428
4: 3312
Right 993159943 5:84277198-84277220 AAGGCGATGGTATTAAGAGGTGG No data
993159935_993159941 5 Left 993159935 5:84277167-84277189 CCAAGATTCATATGTTGAAATTT 0: 1
1: 30
2: 341
3: 1428
4: 3312
Right 993159941 5:84277195-84277217 CCCAAGGCGATGGTATTAAGAGG 0: 1
1: 34
2: 261
3: 880
4: 2085
993159935_993159945 10 Left 993159935 5:84277167-84277189 CCAAGATTCATATGTTGAAATTT 0: 1
1: 30
2: 341
3: 1428
4: 3312
Right 993159945 5:84277200-84277222 GGCGATGGTATTAAGAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993159935 Original CRISPR AAATTTCAACATATGAATCT TGG (reversed) Intronic
Too many off-targets to display for this crispr