ID: 993159941

View in Genome Browser
Species Human (GRCh38)
Location 5:84277195-84277217
Sequence CCCAAGGCGATGGTATTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3261
Summary {0: 1, 1: 34, 2: 261, 3: 880, 4: 2085}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993159932_993159941 8 Left 993159932 5:84277164-84277186 CCCCCAAGATTCATATGTTGAAA 0: 3
1: 289
2: 1258
3: 2754
4: 4242
Right 993159941 5:84277195-84277217 CCCAAGGCGATGGTATTAAGAGG 0: 1
1: 34
2: 261
3: 880
4: 2085
993159935_993159941 5 Left 993159935 5:84277167-84277189 CCAAGATTCATATGTTGAAATTT 0: 1
1: 30
2: 341
3: 1428
4: 3312
Right 993159941 5:84277195-84277217 CCCAAGGCGATGGTATTAAGAGG 0: 1
1: 34
2: 261
3: 880
4: 2085
993159933_993159941 7 Left 993159933 5:84277165-84277187 CCCCAAGATTCATATGTTGAAAT 0: 3
1: 273
2: 1058
3: 2544
4: 3892
Right 993159941 5:84277195-84277217 CCCAAGGCGATGGTATTAAGAGG 0: 1
1: 34
2: 261
3: 880
4: 2085
993159931_993159941 9 Left 993159931 5:84277163-84277185 CCCCCCAAGATTCATATGTTGAA 0: 4
1: 201
2: 1008
3: 2226
4: 3160
Right 993159941 5:84277195-84277217 CCCAAGGCGATGGTATTAAGAGG 0: 1
1: 34
2: 261
3: 880
4: 2085
993159934_993159941 6 Left 993159934 5:84277166-84277188 CCCAAGATTCATATGTTGAAATT 0: 1
1: 57
2: 541
3: 1592
4: 3462
Right 993159941 5:84277195-84277217 CCCAAGGCGATGGTATTAAGAGG 0: 1
1: 34
2: 261
3: 880
4: 2085

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993159941 Original CRISPR CCCAAGGCGATGGTATTAAG AGG Intronic
Too many off-targets to display for this crispr