ID: 993159943

View in Genome Browser
Species Human (GRCh38)
Location 5:84277198-84277220
Sequence AAGGCGATGGTATTAAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993159935_993159943 8 Left 993159935 5:84277167-84277189 CCAAGATTCATATGTTGAAATTT 0: 1
1: 30
2: 341
3: 1428
4: 3312
Right 993159943 5:84277198-84277220 AAGGCGATGGTATTAAGAGGTGG No data
993159933_993159943 10 Left 993159933 5:84277165-84277187 CCCCAAGATTCATATGTTGAAAT 0: 3
1: 273
2: 1058
3: 2544
4: 3892
Right 993159943 5:84277198-84277220 AAGGCGATGGTATTAAGAGGTGG No data
993159934_993159943 9 Left 993159934 5:84277166-84277188 CCCAAGATTCATATGTTGAAATT 0: 1
1: 57
2: 541
3: 1592
4: 3462
Right 993159943 5:84277198-84277220 AAGGCGATGGTATTAAGAGGTGG No data
993159932_993159943 11 Left 993159932 5:84277164-84277186 CCCCCAAGATTCATATGTTGAAA 0: 3
1: 289
2: 1258
3: 2754
4: 4242
Right 993159943 5:84277198-84277220 AAGGCGATGGTATTAAGAGGTGG No data
993159931_993159943 12 Left 993159931 5:84277163-84277185 CCCCCCAAGATTCATATGTTGAA 0: 4
1: 201
2: 1008
3: 2226
4: 3160
Right 993159943 5:84277198-84277220 AAGGCGATGGTATTAAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993159943 Original CRISPR AAGGCGATGGTATTAAGAGG TGG Intronic
No off target data available for this crispr