ID: 993159944

View in Genome Browser
Species Human (GRCh38)
Location 5:84277199-84277221
Sequence AGGCGATGGTATTAAGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3821
Summary {0: 1, 1: 35, 2: 329, 3: 1175, 4: 2281}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993159932_993159944 12 Left 993159932 5:84277164-84277186 CCCCCAAGATTCATATGTTGAAA 0: 3
1: 289
2: 1258
3: 2754
4: 4242
Right 993159944 5:84277199-84277221 AGGCGATGGTATTAAGAGGTGGG 0: 1
1: 35
2: 329
3: 1175
4: 2281
993159933_993159944 11 Left 993159933 5:84277165-84277187 CCCCAAGATTCATATGTTGAAAT 0: 3
1: 273
2: 1058
3: 2544
4: 3892
Right 993159944 5:84277199-84277221 AGGCGATGGTATTAAGAGGTGGG 0: 1
1: 35
2: 329
3: 1175
4: 2281
993159931_993159944 13 Left 993159931 5:84277163-84277185 CCCCCCAAGATTCATATGTTGAA 0: 4
1: 201
2: 1008
3: 2226
4: 3160
Right 993159944 5:84277199-84277221 AGGCGATGGTATTAAGAGGTGGG 0: 1
1: 35
2: 329
3: 1175
4: 2281
993159934_993159944 10 Left 993159934 5:84277166-84277188 CCCAAGATTCATATGTTGAAATT 0: 1
1: 57
2: 541
3: 1592
4: 3462
Right 993159944 5:84277199-84277221 AGGCGATGGTATTAAGAGGTGGG 0: 1
1: 35
2: 329
3: 1175
4: 2281
993159935_993159944 9 Left 993159935 5:84277167-84277189 CCAAGATTCATATGTTGAAATTT 0: 1
1: 30
2: 341
3: 1428
4: 3312
Right 993159944 5:84277199-84277221 AGGCGATGGTATTAAGAGGTGGG 0: 1
1: 35
2: 329
3: 1175
4: 2281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993159944 Original CRISPR AGGCGATGGTATTAAGAGGT GGG Intronic
Too many off-targets to display for this crispr