ID: 993159946

View in Genome Browser
Species Human (GRCh38)
Location 5:84277208-84277230
Sequence TATTAAGAGGTGGGGCTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6378
Summary {0: 17, 1: 238, 2: 943, 3: 2010, 4: 3170}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993159931_993159946 22 Left 993159931 5:84277163-84277185 CCCCCCAAGATTCATATGTTGAA 0: 4
1: 201
2: 1008
3: 2226
4: 3160
Right 993159946 5:84277208-84277230 TATTAAGAGGTGGGGCTTTTAGG 0: 17
1: 238
2: 943
3: 2010
4: 3170
993159940_993159946 -10 Left 993159940 5:84277195-84277217 CCCAAGGCGATGGTATTAAGAGG 0: 1
1: 37
2: 278
3: 949
4: 1877
Right 993159946 5:84277208-84277230 TATTAAGAGGTGGGGCTTTTAGG 0: 17
1: 238
2: 943
3: 2010
4: 3170
993159934_993159946 19 Left 993159934 5:84277166-84277188 CCCAAGATTCATATGTTGAAATT 0: 1
1: 57
2: 541
3: 1592
4: 3462
Right 993159946 5:84277208-84277230 TATTAAGAGGTGGGGCTTTTAGG 0: 17
1: 238
2: 943
3: 2010
4: 3170
993159939_993159946 -9 Left 993159939 5:84277194-84277216 CCCCAAGGCGATGGTATTAAGAG 0: 1
1: 42
2: 305
3: 900
4: 1898
Right 993159946 5:84277208-84277230 TATTAAGAGGTGGGGCTTTTAGG 0: 17
1: 238
2: 943
3: 2010
4: 3170
993159932_993159946 21 Left 993159932 5:84277164-84277186 CCCCCAAGATTCATATGTTGAAA 0: 3
1: 289
2: 1258
3: 2754
4: 4242
Right 993159946 5:84277208-84277230 TATTAAGAGGTGGGGCTTTTAGG 0: 17
1: 238
2: 943
3: 2010
4: 3170
993159933_993159946 20 Left 993159933 5:84277165-84277187 CCCCAAGATTCATATGTTGAAAT 0: 3
1: 273
2: 1058
3: 2544
4: 3892
Right 993159946 5:84277208-84277230 TATTAAGAGGTGGGGCTTTTAGG 0: 17
1: 238
2: 943
3: 2010
4: 3170
993159938_993159946 -8 Left 993159938 5:84277193-84277215 CCCCCAAGGCGATGGTATTAAGA 0: 1
1: 25
2: 224
3: 645
4: 1264
Right 993159946 5:84277208-84277230 TATTAAGAGGTGGGGCTTTTAGG 0: 17
1: 238
2: 943
3: 2010
4: 3170
993159935_993159946 18 Left 993159935 5:84277167-84277189 CCAAGATTCATATGTTGAAATTT 0: 1
1: 30
2: 341
3: 1428
4: 3312
Right 993159946 5:84277208-84277230 TATTAAGAGGTGGGGCTTTTAGG 0: 17
1: 238
2: 943
3: 2010
4: 3170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993159946 Original CRISPR TATTAAGAGGTGGGGCTTTT AGG Intronic
Too many off-targets to display for this crispr