ID: 993160679

View in Genome Browser
Species Human (GRCh38)
Location 5:84286871-84286893
Sequence AGTTCAGCTTAAAACCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993160679_993160682 2 Left 993160679 5:84286871-84286893 CCACTGAGGTTTTAAGCTGAACT 0: 1
1: 0
2: 0
3: 7
4: 107
Right 993160682 5:84286896-84286918 TGGAATTGTGCCCAGTCTTTGGG 0: 1
1: 0
2: 1
3: 12
4: 158
993160679_993160681 1 Left 993160679 5:84286871-84286893 CCACTGAGGTTTTAAGCTGAACT 0: 1
1: 0
2: 0
3: 7
4: 107
Right 993160681 5:84286895-84286917 CTGGAATTGTGCCCAGTCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993160679 Original CRISPR AGTTCAGCTTAAAACCTCAG TGG (reversed) Intronic
900377531 1:2363080-2363102 AGTACACATTAAAACCTAAGTGG + Intronic
901091135 1:6642242-6642264 TCTTCTGCCTAAAACCTCAGAGG - Intronic
902563397 1:17293490-17293512 AATTCAAATTAAAACCTCAGTGG + Intergenic
906478113 1:46183527-46183549 AGCTCAACTCCAAACCTCAGGGG - Intronic
910163354 1:84298214-84298236 AGTCCAGCTTAAAACTTCATTGG + Intergenic
916648656 1:166815143-166815165 CCTTCAGCTTAATTCCTCAGGGG + Intergenic
923850672 1:237790804-237790826 GGTTCAGTTTACAACCTCCGAGG - Intronic
1067341609 10:45410120-45410142 AGTTAATTTTAAAAGCTCAGTGG - Intronic
1067692933 10:48514852-48514874 AGTTCAGATTAATACTTCAGTGG - Intronic
1068892517 10:62162463-62162485 AGTTTAGCTAAAGCCCTCAGGGG - Intergenic
1073532778 10:104247441-104247463 AGTTCAGATTATACTCTCAGAGG + Intronic
1077732672 11:4750207-4750229 AGTGCAGATTAAAACCACAATGG + Intronic
1079316072 11:19408885-19408907 CATGCAGCTTAAAACCCCAGTGG - Intronic
1079772658 11:24482352-24482374 ATTTCATATTAAAACCTCACTGG - Intergenic
1086502497 11:87467675-87467697 ATTCCAGCCTAAAACCTCATAGG - Intergenic
1087406582 11:97738737-97738759 AATTCAGCTTTAAACCTTATTGG + Intergenic
1087634068 11:100683645-100683667 AGTTCAGATTAAGCCCTTAGAGG - Intergenic
1087798146 11:102475853-102475875 AATTCAGCTTAAACCATAAGTGG - Intronic
1087882951 11:103440420-103440442 AGTTCAGCAAAAAAACTGAGTGG - Intronic
1089751426 11:120654084-120654106 AGTACAGCTTCCAACCTCAGAGG - Intronic
1099927775 12:89038996-89039018 AGTTCAGCTTCATAGCCCAGTGG - Intergenic
1100390792 12:94145058-94145080 TGGTCTGCTTAAAACCTAAGAGG + Intergenic
1101596455 12:106169819-106169841 AGTTCTGCTTAGAAACGCAGAGG - Intergenic
1103034993 12:117649408-117649430 AGGTCAGCTTTAATCCTCATTGG - Intronic
1103526087 12:121569514-121569536 AGTTCAGCATGTAACCTCCGGGG - Intronic
1104579295 12:129998345-129998367 AGATGAGCCTGAAACCTCAGTGG + Intergenic
1106703155 13:32250814-32250836 TGTTCAGCTGAAAACTTCATTGG + Intronic
1106959312 13:34979156-34979178 AATTCAAATTAAAACCACAGTGG - Intronic
1108794916 13:54019027-54019049 AGTTCACCTTATAACTTCATTGG + Intergenic
1109613961 13:64806955-64806977 AGATAAGCTTACAGCCTCAGAGG + Intergenic
1113067986 13:106391096-106391118 GGTTCATCTTAAAAGATCAGCGG - Intergenic
1115950101 14:38711371-38711393 AATTTAGCTTGAAACCTTAGAGG + Intergenic
1120431332 14:84419398-84419420 AGATCAGCTTAGAACCTGAAGGG - Intergenic
1124810391 15:32931231-32931253 AGTTCCTCTTAAAATCCCAGTGG - Intronic
1128927833 15:71674861-71674883 TATTCAGCTCTAAACCTCAGTGG + Intronic
1131965643 15:97839371-97839393 TGTTCAGCTTAAATACTTAGTGG - Intergenic
1134443985 16:14316859-14316881 AGTTCAGAAAAATACCTCAGTGG + Intergenic
1135181637 16:20279694-20279716 CCTTCAGGTCAAAACCTCAGGGG - Intergenic
1136307654 16:29383147-29383169 AGTTCCGCTTCCACCCTCAGCGG - Exonic
1141286103 16:82673521-82673543 GGTGGAGCTTAAAACCTCACAGG + Intronic
1141496237 16:84411822-84411844 AGCTCAGCTTAGAACATCTGCGG + Intronic
1142336495 16:89492553-89492575 AGTCCAGCTTCAAACTTCCGGGG + Intronic
1142936256 17:3334653-3334675 AGTTCTGCTTAAAATCCCAATGG - Intergenic
1148963562 17:51414333-51414355 AGTTGAAATTAAAACCTCAGTGG + Intergenic
1155794301 18:30015329-30015351 AGTTAAGCTTTGTACCTCAGTGG - Intergenic
1156234641 18:35190388-35190410 AGCGCAGTTTAAAACCTCACAGG - Intergenic
1168357315 19:55710056-55710078 AGTTTATCTTAAATCTTCAGAGG + Intronic
929448927 2:42023685-42023707 AGTAAAGCTTAAAAGCTGAGGGG - Intergenic
931831621 2:66058236-66058258 AGTTAATATTAAAAACTCAGTGG - Intergenic
932050897 2:68396584-68396606 AGATCAGCCTAAAACCAGAGTGG - Exonic
935224929 2:101045219-101045241 AATTCAGCTTAATCCCTAAGAGG + Intronic
935599238 2:104905618-104905640 ATTCCCTCTTAAAACCTCAGAGG - Intergenic
939007902 2:136810221-136810243 AGTTCAGCTTAGCTCCTCTGTGG - Intronic
940815717 2:158294977-158294999 AATACAGGTTAAAACCACAGGGG - Intronic
941128044 2:161610696-161610718 ATTTCAGCTTGAGACCTGAGTGG + Intronic
1169742276 20:8907922-8907944 ATCCCAGCTTACAACCTCAGTGG + Intronic
1170491494 20:16880188-16880210 AGTTTAGCTTTAAAATTCAGTGG + Intergenic
1171153372 20:22847401-22847423 AGAGCAGCATATAACCTCAGGGG + Intergenic
1173100332 20:40081953-40081975 AGTTGATCTTAAAACCTATGTGG - Intergenic
1176139573 20:63539086-63539108 AGCTCAGCTCAAGGCCTCAGTGG + Intergenic
1178432237 21:32526659-32526681 ACTTTTGCTTAAAACTTCAGAGG - Intergenic
1181697344 22:24600418-24600440 AGTCCAGCTCCAAAACTCAGAGG - Intronic
1183390428 22:37542511-37542533 AGTTCTGCTTTAAACCCCACTGG - Intergenic
1184940834 22:47763635-47763657 AGATCGGCATAAATCCTCAGAGG - Intergenic
952095974 3:29954622-29954644 AATGGTGCTTAAAACCTCAGAGG + Intronic
955091515 3:55756048-55756070 TTTTCAGCTTAGAACCACAGAGG - Intronic
955772757 3:62402467-62402489 ATTTCAGCGTGAAATCTCAGTGG - Intronic
960068478 3:113401899-113401921 AGTTCAGAGTAAAATTTCAGGGG - Intronic
964221243 3:154347754-154347776 AATTCATCTTAGATCCTCAGTGG - Intronic
968423462 4:504774-504796 AGTTTAGCATAGAACCTAAGAGG - Intronic
969367495 4:6706510-6706532 AGTTCACCCCAAAACCTTAGTGG - Intergenic
970483628 4:16502921-16502943 AGCTCAGCTTAAAATAACAGTGG + Intronic
973530116 4:51828840-51828862 AGTGCAATTCAAAACCTCAGTGG - Intergenic
974440108 4:61904891-61904913 AGTGAATCATAAAACCTCAGAGG + Intronic
974770911 4:66412429-66412451 AGTGCAAATTAAAACCTCAAAGG + Intergenic
974844948 4:67340916-67340938 TGTACTGCTTAAAATCTCAGGGG + Intergenic
978155013 4:105479678-105479700 AACAAAGCTTAAAACCTCAGAGG + Intergenic
979589907 4:122466164-122466186 AGTGCAGCTTTAATCCACAGTGG - Intergenic
990768412 5:59214280-59214302 AACTCAGCTAAAAACCTCTGTGG + Intronic
992303448 5:75409217-75409239 ACCTCATATTAAAACCTCAGAGG + Intronic
993160679 5:84286871-84286893 AGTTCAGCTTAAAACCTCAGTGG - Intronic
993251409 5:85529043-85529065 AGTACAGCTTAAAAGCTAATAGG - Intergenic
997761535 5:136452892-136452914 AATGCATCTTAAAACCACAGTGG + Intergenic
998677030 5:144421032-144421054 AGTGAAGCTTAAAACCACTGAGG - Intronic
998808966 5:145946833-145946855 AGTTCAACTCATAAACTCAGTGG - Intronic
1003377685 6:5594649-5594671 AATGAAACTTAAAACCTCAGTGG + Intronic
1004837561 6:19545070-19545092 ATTTCAGATTAAATCCTCACGGG + Intergenic
1014802730 6:125795242-125795264 AGTGCAACTTAAAACATAAGAGG + Intronic
1018327181 6:162684272-162684294 AGTTCAGTTTTAAATCTCAAGGG - Intronic
1019259931 7:76358-76380 AGTGCAACTGAAAATCTCAGTGG + Intergenic
1019472257 7:1227320-1227342 AGCTCCGCTTAAAACAACAGAGG + Intergenic
1021312975 7:19116224-19116246 TGTTCAGCTTAATTTCTCAGTGG - Intronic
1023067839 7:36396671-36396693 AGTTATCCTTAAAACCTCAAGGG + Intronic
1024218291 7:47266475-47266497 AGCTCAATTTACAACCTCAGTGG - Intergenic
1030328092 7:108243122-108243144 AGTTTAACTTAAAACTTCTGAGG - Intronic
1033048599 7:137984040-137984062 TGTTCAGCCAAAAACCTCAGTGG - Intronic
1033112546 7:138594249-138594271 AGTTTAGCTACAAACCTCATGGG + Intergenic
1034309360 7:150072973-150072995 TGTTCATCTGAAAACCACAGCGG + Intergenic
1034751868 7:153576400-153576422 AGCTCAGCTTATAGCTTCAGAGG + Intergenic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1035084212 7:156243130-156243152 AGTTCTGCTTTAAATGTCAGGGG + Intergenic
1040695961 8:49999136-49999158 AGTTCAACGTAGATCCTCAGAGG + Intronic
1045067550 8:98463701-98463723 AATTCATCTTAAAATCTCTGGGG + Intronic
1046139489 8:110071592-110071614 AATTCAGCTTAAAATCTCAAAGG - Intergenic
1052633504 9:31071353-31071375 AGCTCAGATGAAAACCACAGTGG + Intergenic
1053549032 9:39055627-39055649 AGGTCAGCTTAAGAGCTAAGAGG + Intergenic
1053813158 9:41875711-41875733 AGGTCAGCTTAATAGCTAAGAGG + Intergenic
1054617437 9:67311728-67311750 AGGTCAGCTTAATAGCTAAGAGG - Intergenic
1057128012 9:92634269-92634291 TTTTCTGCTTTAAACCTCAGGGG + Intronic
1062744768 9:138204101-138204123 AGTGCAACTGAAAATCTCAGTGG - Intergenic
1191906571 X:66098541-66098563 AGTTCAGTTTCTAAACTCAGAGG + Intergenic
1193482730 X:82047051-82047073 AGTTCACCCTAAAACTGCAGTGG + Intergenic
1196093506 X:111772937-111772959 ACCTCATCTGAAAACCTCAGTGG - Intergenic
1197924857 X:131635654-131635676 AATTCAAATTAAAACCACAGTGG - Intergenic
1198825492 X:140694308-140694330 AGATCAGGATAAAACCACAGTGG + Intergenic