ID: 993163931

View in Genome Browser
Species Human (GRCh38)
Location 5:84326807-84326829
Sequence TCTCAAAGAGAGAATGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 339}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993163931 Original CRISPR TCTCAAAGAGAGAATGTAGA AGG (reversed) Intronic
902166805 1:14579025-14579047 TCTCAAACAGAGCATTTAGTGGG - Intergenic
903783613 1:25840402-25840424 TCTCAAAAAAACAATGTGGAGGG + Intronic
904854514 1:33487642-33487664 TCTCAAAAAAAGAAATTAGATGG - Intronic
905134540 1:35788302-35788324 ACTAAAAGAGTGAGTGTAGATGG - Intergenic
908894868 1:68887316-68887338 TCTGAAAGAGGGAATGAATAGGG - Intergenic
910843264 1:91581875-91581897 TATCCATGAGAGAAGGTAGATGG + Intergenic
912789050 1:112633199-112633221 TATCAAAGATAGAAATTAGAGGG - Intronic
915051224 1:153074944-153074966 TCTTCAAGAGAGATTTTAGAAGG - Intergenic
915808665 1:158882028-158882050 TGAGAGAGAGAGAATGTAGATGG - Intergenic
916791925 1:168132690-168132712 TCTGAAAGAGAGAAAACAGAAGG + Intronic
917745071 1:177998844-177998866 TCTCTCAGGGTGAATGTAGAGGG - Intergenic
918840457 1:189529740-189529762 TCTCAGACAGAGAATGAAGTAGG + Intergenic
920018202 1:202930738-202930760 TCACAAAGATAGAGAGTAGAAGG - Intergenic
922919486 1:229290050-229290072 TCTTAAAGATAGGAAGTAGATGG + Intronic
924360721 1:243239002-243239024 TCCCAAAGAGATTATGTATAGGG - Intronic
924612093 1:245581911-245581933 TGTCAAAGAGAGAAAGAGGAAGG + Intronic
1063397968 10:5709611-5709633 TCTCTAAGAGAGAATGTAGCTGG - Intronic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1064882054 10:20066403-20066425 TCTGAAAGTGAGAATGCATAAGG + Intronic
1065172651 10:23047469-23047491 TCTCAAAGACACCATGCAGAAGG + Intergenic
1065412607 10:25445845-25445867 TAACAAAGAGAGGATTTAGAAGG + Intronic
1066342543 10:34550221-34550243 TCTCAAAGATAAAAGGTGGAGGG - Intronic
1069815898 10:71194114-71194136 TCACAAGGAGAGAATCTAAAGGG + Intergenic
1071093643 10:81948710-81948732 TCTCAAAGTGTGAAGTTAGAGGG + Intronic
1071227542 10:83548029-83548051 TCTAAAGGAGGGAAGGTAGAGGG + Intergenic
1072118114 10:92383036-92383058 ACTCTAAGAAAGAATGTGGAAGG - Intergenic
1072292438 10:93976591-93976613 GCTCAAAGAGAGAATCTGGGTGG + Intergenic
1073089951 10:100927284-100927306 TTTCATAGAGACAAAGTAGAAGG - Intronic
1073494190 10:103876542-103876564 TCTCAAAAAAAAAAAGTAGATGG - Intergenic
1073992052 10:109272860-109272882 TCTTATAGAGAGCATGTAGTTGG + Intergenic
1074987635 10:118671664-118671686 TCCTAAAGAGAAAATGCAGAGGG + Intergenic
1076208281 10:128620695-128620717 TCTCAAAGATACCATGTTGAGGG + Intergenic
1077067940 11:652632-652654 TCTCAAAAAGAAAATAGAGAAGG + Intronic
1078320004 11:10326014-10326036 TCTCCAAGAGACCATGCAGAAGG + Intronic
1079536385 11:21520258-21520280 TCTTAAACTGAGAATTTAGAAGG - Intronic
1081463934 11:43299232-43299254 TCACAAAGATAGAGAGTAGAAGG + Intergenic
1083141367 11:60724501-60724523 TCTCAAAGAGAAACTTTGGAAGG + Intergenic
1083191290 11:61054136-61054158 CCTCAAAGACAGTATGTGGATGG + Intergenic
1083675321 11:64321900-64321922 GCTGAAAGGGAGAATGTAGGGGG + Intergenic
1083777004 11:64898913-64898935 TCTCAAAAAAAGAATAGAGAAGG - Intronic
1084683911 11:70682623-70682645 TCTAAAACAGACAATGAAGATGG + Intronic
1085192677 11:74641831-74641853 TCCCTAAGAGAGGATGGAGAGGG + Exonic
1085935541 11:81137443-81137465 TCTCTAAGAGATATTGTAGGAGG - Intergenic
1086227904 11:84534604-84534626 TCTCAAATAGAAAATGTCCATGG - Exonic
1087689843 11:101307717-101307739 TGTCAAAGAGAGAAATTAAAAGG + Intergenic
1087705024 11:101480341-101480363 TCTAAGAGGGAGAATATAGAAGG - Intronic
1087882076 11:103428668-103428690 TCACAGAGACAGAAAGTAGATGG - Intronic
1089034609 11:115373955-115373977 TCTTAAAGATAAAATGTATAAGG - Intronic
1089426528 11:118380962-118380984 TCTGAAAGAGTGAATGTGGGAGG + Intronic
1089482942 11:118821760-118821782 TCTGAAAGAGTAAATGTAAACGG - Intergenic
1090466879 11:126942844-126942866 TCTCAGAGAGAGAAGGAAAAGGG - Intronic
1090999078 11:131893249-131893271 TTTGAAAGTGAGAATGTAGGAGG + Intronic
1092181205 12:6448197-6448219 TGTCAAAGAGAGAATGTCAAAGG - Intronic
1093150709 12:15617857-15617879 TCTCAAAAAGAGAAAGTAGGAGG + Intergenic
1093401369 12:18750978-18751000 TCTCAAATAGGTACTGTAGATGG + Intergenic
1093837918 12:23859214-23859236 TCTCACAGAGAGCCTATAGATGG + Intronic
1093941041 12:25054803-25054825 TCTCAAAGATTGAATTTAAAGGG - Intronic
1095898568 12:47305179-47305201 CCTCTAAGGGAGAATGGAGATGG + Intergenic
1096666549 12:53170126-53170148 TCTGAAAAAGAAAATGCAGAGGG + Exonic
1098165063 12:67687803-67687825 ACTCAAACAGAGAGAGTAGAAGG + Intergenic
1098524265 12:71469126-71469148 GCTCAGAGAATGAATGTAGAAGG - Intronic
1098581498 12:72104355-72104377 TCTGAAAGAGAGAATAGAGAGGG + Intronic
1099812968 12:87608417-87608439 TCTACAAGAGAGAAAGAAGAAGG - Intergenic
1100258387 12:92907382-92907404 TCTGAGATGGAGAATGTAGATGG - Intronic
1101204504 12:102472270-102472292 TCACAAACAGATAATCTAGAAGG + Intronic
1102471966 12:113164273-113164295 TCTCAAAGATAGTCTGTGGAGGG + Exonic
1102809983 12:115815808-115815830 TTTCCAAGACAGAATGGAGAGGG - Intergenic
1104619683 12:130301797-130301819 TCTGGAAGAGAGAATTTGGAAGG - Intergenic
1104943498 12:132405514-132405536 TCTCAGAGACAGAAAGCAGAAGG + Intergenic
1105804159 13:23940081-23940103 TCTCACAGAGAGCTTATAGATGG - Intergenic
1106041961 13:26102230-26102252 TCACAGAGACAGAAAGTAGATGG - Intergenic
1106265360 13:28104907-28104929 TCTCAAAAACATAATGTTGAGGG + Intergenic
1106815374 13:33401676-33401698 TCTGAGAGAGAAAATGGAGAGGG - Intergenic
1110598002 13:77340216-77340238 TCCCAATGATAGAATGTAGCTGG + Intergenic
1111163820 13:84431030-84431052 TCTTAAAGAGAAAACGTAAATGG + Intergenic
1111225138 13:85260934-85260956 TCTTAAAGGGAGAAGGAAGAGGG + Intergenic
1111233964 13:85383741-85383763 TCACAGAGGGAGAAGGTAGAGGG - Intergenic
1111992690 13:95132870-95132892 ACTCAGAGACAGAAAGTAGAAGG + Intronic
1112259163 13:97862895-97862917 ACGCAAAGAGAGAATGAGGAAGG + Intergenic
1112523035 13:100115231-100115253 ACTCATAGAGAGAGAGTAGAAGG + Intronic
1112722979 13:102266473-102266495 TCTCAAAGAGAGAATACAGGAGG + Intronic
1113314883 13:109168332-109168354 TCTGAAAGAGTAAATGTAAAGGG + Intronic
1115815560 14:37160926-37160948 TCTCAAAGAAAGAAAGAAGGAGG + Intronic
1116069603 14:40026735-40026757 TCTCAAAGAGGCAATGGAGAAGG + Intergenic
1116160927 14:41265803-41265825 TCTCAAATACAGAATTCAGATGG + Intergenic
1116965253 14:51007937-51007959 TATCAAAGAGAGATTATATAAGG - Intronic
1117427435 14:55615411-55615433 TCATAAAGACAGAAAGTAGAAGG - Intronic
1117533309 14:56680116-56680138 TATCAAAGAGATAGTGCAGATGG + Intronic
1118092850 14:62501663-62501685 TCTCTAAGAGAAAATGGAAAAGG - Intergenic
1118828775 14:69409258-69409280 TATAAAAGGGAGAATGTAAATGG - Intronic
1119800450 14:77440441-77440463 TCTCACAAAGAAAATGTTGAAGG - Intronic
1120375059 14:83694546-83694568 TCTCAAGTAGTGAAAGTAGAAGG + Intergenic
1120822933 14:88929679-88929701 TCATAAAGACAGAAAGTAGAAGG - Intergenic
1122720202 14:103717506-103717528 TCTGGAAGAGAGAATGAAGGAGG - Intronic
1123169436 14:106357804-106357826 TCTCATAGAAAGAGTTTAGAAGG - Intergenic
1123956329 15:25339172-25339194 ACTTAAAGAGAGATTGTTGAAGG - Exonic
1124384998 15:29200176-29200198 TCTCAAAAAAAAAATGTATATGG - Intronic
1125125866 15:36220301-36220323 TCCAAAAGAGAGAAAGTAAATGG - Intergenic
1126098633 15:45106552-45106574 ACTCAAAGAGAGCGTGAAGAAGG - Exonic
1126470136 15:49001174-49001196 TCTCTAAGAGAAAATATATATGG + Intronic
1127131820 15:55873778-55873800 TCTTAAAGAGAAAATGGAAACGG + Intronic
1127648640 15:60984295-60984317 TCACAAAGAGAGGTTGGAGAAGG + Intronic
1129201403 15:74003577-74003599 TCTGAAAGTGAGAAGGAAGAGGG - Intronic
1129994107 15:79990069-79990091 TATCAAAGATAGAATTTACAGGG - Intergenic
1131510376 15:93046627-93046649 GCTCAAAGAAAGAATGAATAGGG + Intronic
1133944694 16:10338483-10338505 TCTCAAAGAGAGAGGGTTTATGG + Intronic
1135170254 16:20177592-20177614 TCGCAAAGACAGAGTGTAGGAGG + Intergenic
1136273791 16:29165989-29166011 TCTCAAATACAGAATTCAGATGG - Intergenic
1138959339 16:62010248-62010270 TCTCATAATGAGAATGTAAAAGG - Intronic
1139963851 16:70734298-70734320 TCTCAAAGAAAAAATTTAGCTGG - Intronic
1140301718 16:73764424-73764446 TCACAAAGAAAGACTGCAGAGGG + Intergenic
1140316684 16:73905111-73905133 TCTCAAGTAGAGAGTGAAGATGG + Intergenic
1140704747 16:77616847-77616869 TCTCAGAGACATAATGTAGAAGG - Intergenic
1141239434 16:82251372-82251394 TCATAAAGACAGAAAGTAGAAGG - Intergenic
1142077334 16:88127734-88127756 TCTCAAATACAGAATTCAGATGG - Intergenic
1142534870 17:607252-607274 TCCCAAAGAGACAAAGTAGTTGG - Intronic
1143330159 17:6128539-6128561 GCTGAAAGATAGAAAGTAGACGG - Intergenic
1145064182 17:19750888-19750910 ACTCAAGGAGAGTAGGTAGAGGG - Intergenic
1146171711 17:30639508-30639530 TCATAAAGACAGAAAGTAGAAGG - Intergenic
1146345170 17:32055533-32055555 TCATAAAGACAGAAAGTAGAAGG - Intergenic
1147195213 17:38761961-38761983 TAGCCAAGACAGAATGTAGAAGG + Intronic
1147409971 17:40243444-40243466 TCTGAAAGAGAAAATGAAGGAGG - Intronic
1147517304 17:41132500-41132522 TGTCAATGAGTAAATGTAGAAGG + Intergenic
1148118866 17:45195620-45195642 TCTCACAGATATAATGTTGAAGG - Intergenic
1149999411 17:61424234-61424256 TCTCAAAGAGAGAGGGGAGCTGG + Intergenic
1150156626 17:62859165-62859187 ACTCAAAGAGGAAATGTATAAGG - Intergenic
1150665826 17:67136750-67136772 TCATAGAGAAAGAATGTAGAAGG + Intronic
1151192993 17:72412313-72412335 TCTCAAAAAAAGAAAGAAGAAGG - Intergenic
1151246745 17:72800766-72800788 TCGCAAATAGAGAATTGAGAGGG + Intronic
1151250662 17:72831747-72831769 TCTTTAAGAGAGAATGAACAAGG - Intronic
1152054438 17:78012522-78012544 TCTCAAAGAGATATTTTAGTGGG + Intronic
1152402041 17:80072347-80072369 TCACAAAAAGAGAAAGTCGATGG - Intronic
1152498064 17:80688555-80688577 GCTCAAAGGGAGAAAGAAGAAGG + Intronic
1156156356 18:34307393-34307415 TCATAGAGACAGAATGTAGAAGG + Intergenic
1156986544 18:43356995-43357017 TCACAAAGATAGAAGGTAAATGG - Intergenic
1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG + Intronic
1157536670 18:48464039-48464061 TGTCAGAGAGAGATTGCAGATGG - Intergenic
1158409734 18:57194920-57194942 TCTGAAAGAGAGAAGCCAGAAGG + Intergenic
1159490648 18:69129425-69129447 CCACAAAGGGAGAATTTAGACGG - Intergenic
1159823805 18:73180115-73180137 TCTCATAGGCAGAATGTAGTTGG - Intronic
1160165189 18:76505283-76505305 TTTCAAAGATAACATGTAGACGG + Intergenic
1161914144 19:7216320-7216342 TCTCAAAGACAAAAAGAAGATGG + Intronic
1162638885 19:11991537-11991559 TCTAAAAGAGAGACAGTATAAGG + Intergenic
1163810278 19:19427092-19427114 TCTTAAAGACAGAAGGAAGAAGG + Intronic
1166534935 19:43567223-43567245 TCTGAATTAGAGAATGGAGATGG + Intronic
926500674 2:13649174-13649196 CCACAAAGAGAGGATGGAGAAGG + Intergenic
927624078 2:24694685-24694707 ACTCAAAAACAGAATGAAGAAGG - Intronic
928205835 2:29282790-29282812 CCTCAAACTGAGAATGTGGAAGG - Intronic
928713305 2:34031765-34031787 GCTGAAAAAGAGAATTTAGAGGG + Intergenic
928799854 2:35074787-35074809 TCTTAAAGAGAAAGTATAGATGG + Intergenic
928849790 2:35731521-35731543 TCTCTCAGAGAAAATGAAGATGG - Intergenic
929992029 2:46798374-46798396 TTTGAAAGAGAGAATAGAGAAGG + Intergenic
930720380 2:54632241-54632263 TCTCAAAGAGAGAGTATGAAGGG + Intronic
931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG + Intronic
931027861 2:58134240-58134262 TCTTAAAGGGAGAAGGGAGAGGG - Intronic
931397467 2:61900586-61900608 TCTAAAAGGGAGGAAGTAGAAGG + Intronic
932136926 2:69239549-69239571 TCTCAAAAAAAAAATGTTGATGG + Intronic
933075743 2:77924047-77924069 GTACAAAGAAAGAATGTAGATGG - Intergenic
933216807 2:79639802-79639824 TTTTAAAGAGAGAATATCGAAGG + Intronic
933424374 2:82091095-82091117 TCTCAAAAGGAGCATGTAGTAGG - Intergenic
934535926 2:95133330-95133352 TCTCAAAAAGAAAAAGAAGAAGG + Intronic
935929854 2:108112838-108112860 CCTCAAAGATTGAAGGTAGATGG - Intergenic
937029306 2:118724795-118724817 TCTCACAGAGAGTATGTTGCAGG - Intergenic
938372760 2:130783007-130783029 TCTTATAGACAGCATGTAGATGG - Intergenic
938594513 2:132774148-132774170 TCTGAAGGAGAGAATTTACAGGG + Intronic
940053331 2:149487555-149487577 TCTCAAAGATAAAATATTGATGG - Intergenic
940103032 2:150063913-150063935 TCTCTAAGAGAACATGTAAAGGG - Intergenic
940194973 2:151083820-151083842 ACACAAAGAGAGGATGAAGAGGG + Intergenic
940388563 2:153103858-153103880 TCTCAAAGAGTGAATGAACTGGG - Intergenic
940504236 2:154532515-154532537 TGTGAATGAGTGAATGTAGAAGG + Intergenic
941388689 2:164884808-164884830 TCTGTAAGAGATAAAGTAGAAGG - Intergenic
941567971 2:167132120-167132142 TCTTAAAGAAAGAATGATGATGG - Intronic
941576109 2:167232388-167232410 ACTCAAAGAGAGAAGGAAAAAGG - Intronic
941833484 2:169989478-169989500 TCTCACAGAGAGAAAACAGAGGG - Intronic
941965180 2:171293532-171293554 GCTTAAAGAGAGAATGGGGAGGG + Intergenic
943049812 2:182900942-182900964 AGTCAAGGAGAGAAGGTAGAAGG - Intergenic
943916565 2:193642986-193643008 TCTCAAGCAGAGAATGGAGAGGG - Intergenic
943990383 2:194682420-194682442 CCTCAAACAGAGTATATAGAAGG + Intergenic
944508900 2:200445031-200445053 TCTAAAAGTGAGAATGTGGCAGG + Intronic
945140599 2:206682583-206682605 CATCAAAGAGAGAGTGTAGAGGG - Intronic
946117217 2:217473627-217473649 TCTCAAGGAGAGACTGGACAGGG - Intronic
946561881 2:220922986-220923008 TCTCAAAGAAAGAATAAAAATGG - Intergenic
946972865 2:225115055-225115077 TCTAGAAGAGAGAATCTTGAGGG - Intergenic
947288316 2:228543199-228543221 GAGCAAAGACAGAATGTAGAAGG - Intergenic
948508419 2:238447039-238447061 TCGCAAAGAGAGAATACTGAAGG - Exonic
1169236121 20:3931192-3931214 GCTCAAAGATAGAATGTTGCTGG - Intronic
1170099287 20:12680977-12680999 CCTCAGAGACAGAATGAAGATGG + Intergenic
1170560705 20:17555841-17555863 TATGAAAGAGAAAATGTATAAGG + Intronic
1170704187 20:18729869-18729891 ACTCAGAGAGAGAAGGAAGAAGG - Intronic
1170897540 20:20429676-20429698 TTTCAAAGAGAGAATGAATTTGG + Intronic
1171850751 20:30306349-30306371 TTTCAAAGAGAGAGTGTCCATGG - Intergenic
1172758442 20:37304929-37304951 TCCTAAGGAGAGAATGTGGAGGG + Intronic
1173038723 20:39439235-39439257 TCTAAAGGAGAAAAGGTAGATGG - Intergenic
1173612347 20:44378988-44379010 TCACAGAGACAGAAAGTAGAAGG - Intronic
1174126620 20:48311292-48311314 TCTCTAAGGGAGCATATAGATGG + Intergenic
1174604233 20:51749214-51749236 TTTCAAAAAGGGAATGAAGAAGG + Intronic
1174830680 20:53809325-53809347 TCTCAAAGGTAGAACCTAGAAGG - Intergenic
1175172096 20:57087948-57087970 TCTTAAAAAGAGACTCTAGAAGG - Intergenic
1176081567 20:63275994-63276016 CCTCAAGGAGCGAATGCAGAGGG - Intronic
1176923099 21:14712828-14712850 TATCAAAGAGAGTATGTATTTGG + Intergenic
1177862960 21:26476505-26476527 TGTCAAAGAATAAATGTAGAAGG - Intronic
1182986830 22:34726985-34727007 TCTCATAGACAGAATATAGTTGG - Intergenic
1183371659 22:37435953-37435975 GCACAAAGAGAGGATGTTGATGG - Intergenic
1183501191 22:38180728-38180750 TTTGAATGAGAAAATGTAGAAGG - Intronic
1184297821 22:43536983-43537005 CATCAAAGAGTGAATGTTGATGG + Intronic
1185172148 22:49300315-49300337 TCTCAAAGAGGAAATGTGGGAGG + Intergenic
949195918 3:1307260-1307282 TATCAAATAGAGACTGGAGAGGG + Intronic
949730603 3:7108199-7108221 TCTGAAATATATAATGTAGAAGG - Intronic
949927920 3:9056881-9056903 TCTCAAAAAAAGAAGGCAGAGGG - Intronic
950036078 3:9886788-9886810 TCTCAAAAAGAAAATGCAAATGG - Intergenic
950073304 3:10169528-10169550 TCTCACAGAGAGCCTATAGATGG - Intronic
950924575 3:16727689-16727711 TCTCCAAGATAGCATCTAGAGGG - Intergenic
951069856 3:18314636-18314658 TCACAGAGATAGAAAGTAGAGGG - Intronic
951980705 3:28563630-28563652 TCCTAAAGACAGAAAGTAGAAGG + Intergenic
952556434 3:34536557-34536579 TCTCAAAAAGTAAATATAGAAGG - Intergenic
953507745 3:43502885-43502907 TCATAAAGACAGAAAGTAGAAGG + Intronic
954343606 3:49976547-49976569 TCCCAAAGAAAGCATGTATAAGG - Intronic
954863799 3:53712190-53712212 TCTCAGAAAGACAATGGAGAAGG - Intronic
955618701 3:60837508-60837530 TCTCATAGACAGAATATAGTTGG + Intronic
959198717 3:103219297-103219319 TCACAGAGAGAGAATGTAATGGG + Intergenic
959422199 3:106142801-106142823 TCTCAAAGAAAGCATGATGATGG + Intergenic
959865343 3:111261963-111261985 TCTTAAAGACACAATATAGATGG - Intronic
961988337 3:131160657-131160679 TCTCAAAGACAGCATATAGTTGG - Intronic
962126185 3:132621292-132621314 TCTGAAAAAGAGAAAGAAGAGGG + Intronic
962643343 3:137411449-137411471 TCTCAAAGGGAGAATCTGTAGGG + Intergenic
965233188 3:166080218-166080240 TATTAATGATAGAATGTAGATGG - Intergenic
966016278 3:175141463-175141485 TTTCAAATAGAGAGAGTAGAGGG + Intronic
966405740 3:179595669-179595691 TCACAAAGATAGAAAGTAAATGG + Intronic
966591139 3:181684147-181684169 TCTCAAAGAGAGAGAGAAGGGGG - Intergenic
967364915 3:188675266-188675288 TCTCACAGACAGAATGAAGTGGG + Intronic
969863459 4:10055837-10055859 GCTGCAAGAGAGAATGAAGAAGG - Intergenic
970775107 4:19664318-19664340 TCTGAAAAATAGAAGGTAGATGG + Intergenic
972133389 4:35863267-35863289 TCTGTAAGAGAGAAGGTAAATGG - Intergenic
973115763 4:46456495-46456517 TCCCAAAGAGACAAGGGAGAAGG + Intronic
974184453 4:58428856-58428878 AATGAAAGAGAGAATGTAAAAGG - Intergenic
974225791 4:59041661-59041683 TCTCAAAGAAAGCATGTCAAGGG + Intergenic
974358707 4:60846902-60846924 TCACAAGAAGAGAATCTAGAAGG - Intergenic
975450973 4:74526333-74526355 TGTCAGAGAGAAAATGAAGAGGG + Intergenic
976847754 4:89509781-89509803 GCTGAAAGTGAGAAAGTAGAGGG - Intergenic
977045347 4:92062246-92062268 TGTCACAAAGAGAATGAAGAAGG + Intergenic
977179226 4:93853748-93853770 TCTGGAAGAATGAATGTAGAAGG - Intergenic
978189186 4:105893946-105893968 CCTCAAAAAGAAAATGAAGATGG + Intronic
979514365 4:121590130-121590152 TTTTAAAGAGGGAATGAAGAGGG - Intergenic
980589966 4:134873648-134873670 ACTGACAGAGAGAAGGTAGATGG + Intergenic
980675137 4:136068589-136068611 TCTCAAAGAGAGCAGATGGATGG - Intergenic
981101870 4:140837930-140837952 TCTCTAAGTGAGAATCTAGAAGG + Intergenic
981812037 4:148786534-148786556 TATCAAAGAGAGAAGGCAGTTGG - Intergenic
982949905 4:161680723-161680745 TCTCACAGGGAAAATTTAGAAGG - Intronic
984723345 4:182997347-182997369 TCTTAAAGAGAGCATATAGTTGG - Intergenic
985507396 5:291425-291447 TCTCAGGCAGAGAATGGAGACGG - Intronic
985507405 5:291492-291514 TCTCAGGGAGAGAATGGAGATGG - Intronic
985507415 5:291559-291581 TCTCAGGGAGAGAATGGAGACGG - Intronic
985507426 5:291626-291648 TCTCAGGGAGAGAATGGAGACGG - Intronic
985507436 5:291693-291715 TCTCAGGGAGAGAATGGAGACGG - Intronic
985740537 5:1613440-1613462 TCTCAGGGAGAGAATGGAGACGG + Intergenic
985740547 5:1613507-1613529 TCTCAGGGAGAGAATGGAGACGG + Intergenic
985740557 5:1613574-1613596 TCTCAGGGAGAGAATGGAGACGG + Intergenic
985740567 5:1613641-1613663 TCTCAGGGAGAGAATGGAGACGG + Intergenic
985740576 5:1613708-1613730 TCTCAGGGAGAGAATGGAGACGG + Intergenic
987287201 5:16468248-16468270 TCTCAAAGTGAGTATCCAGATGG - Intergenic
987817666 5:22923888-22923910 TCTCAAAGGGCCAGTGTAGATGG + Intergenic
988209285 5:28182491-28182513 TCTCAAAGAGAGTATTCAAAAGG + Intergenic
988504930 5:31813788-31813810 TTTCAAAGAAAGAGTGTAGTGGG + Intronic
989752945 5:44917776-44917798 TATCAAAGAGAATATATAGATGG - Intergenic
990859110 5:60305904-60305926 TCTTAAAGAGAAAAAGTAGCTGG + Intronic
991504121 5:67306404-67306426 TTACAAAGAGAGAATTTTGATGG + Intergenic
992043676 5:72863233-72863255 TCTCAAAGAGCGGAGGTTGAAGG + Intronic
992092544 5:73330782-73330804 TCTTATAGACAGAATGTAGCTGG + Intergenic
992828842 5:80574325-80574347 TCTAGAAGACAGAAAGTAGATGG - Intergenic
992966480 5:82006780-82006802 TCATAAAGATAGAAAGTAGAAGG - Intronic
993163931 5:84326807-84326829 TCTCAAAGAGAGAATGTAGAAGG - Intronic
993648726 5:90492270-90492292 TTTCAAAGATTGACTGTAGAAGG - Intronic
993876739 5:93316323-93316345 TCACAAAGACAAAATGTAGAAGG - Intergenic
993976080 5:94482850-94482872 TATCAAACACAGGATGTAGAAGG - Intronic
994653934 5:102565330-102565352 TCATAAAGACAGAAAGTAGAAGG - Intergenic
994881082 5:105497536-105497558 TCATAAAGACAGAAAGTAGAAGG + Intergenic
995189528 5:109305853-109305875 TCTCAAAAATAGAATGTTTAAGG - Intergenic
995981060 5:118104851-118104873 TCAAAAAGGGAGAAAGTAGAAGG + Intergenic
997109864 5:131063206-131063228 TCTTAGAGACAGAAAGTAGAAGG + Intergenic
999024463 5:148211187-148211209 TCTCATAGAGTGAGTTTAGAAGG + Intronic
999214496 5:149920577-149920599 TCTCAAAAAGAGAAAGTGGCGGG + Intronic
999771475 5:154779490-154779512 AAAAAAAGAGAGAATGTAGAGGG - Intronic
1000356052 5:160396918-160396940 ACCCAAAGACAGGATGTAGAAGG + Intronic
1001284682 5:170413987-170414009 TGACAAAGAGTCAATGTAGAAGG + Intronic
1003041516 6:2692239-2692261 AATCCAAGAGAGAATATAGATGG - Intronic
1003110259 6:3247291-3247313 TCTCACAAAAAGAATGTACACGG - Intronic
1004739960 6:18449937-18449959 TCAAAAATAGAGAAAGTAGATGG + Intronic
1007150005 6:39680547-39680569 TCTCACAGATAGATAGTAGAGGG + Intronic
1007160812 6:39790589-39790611 TCTTAAAGAGAGTTTGTGGAAGG + Intergenic
1007179284 6:39916805-39916827 ACTGAAAGAGAGAAAGCAGATGG + Intronic
1007649480 6:43409512-43409534 CATCAAAAAGAGTATGTAGATGG + Intergenic
1008141639 6:47838910-47838932 TCTCAAAGAAAGAAAGAAAATGG - Intergenic
1009287715 6:61843134-61843156 TCACAAAGACAGAAAGTAGATGG + Intronic
1009393894 6:63174820-63174842 TCTCAAAAACATAATGTTGAGGG + Intergenic
1009617855 6:66033692-66033714 TCAGAGAGAGAGAGTGTAGAAGG - Intergenic
1010094105 6:72019513-72019535 CCTCAAATAGAAAATGTAAAAGG - Intronic
1013060656 6:106630455-106630477 TCTGCAAGATAGAATGAAGAGGG - Intronic
1013307179 6:108860174-108860196 ATACAAAGAGATAATGTAGAGGG - Intronic
1013727702 6:113120052-113120074 TCTCATAGCTAGAAGGTAGAAGG - Intergenic
1014284894 6:119486242-119486264 TCACAGAGACAGAAGGTAGAAGG + Intergenic
1016058956 6:139608344-139608366 ACTCAAAGACAGGATGGAGATGG + Intergenic
1016718523 6:147264632-147264654 TTTCAAAGAGAAAAATTAGACGG + Intronic
1018417066 6:163610884-163610906 TCTCAAGGATAGAAAGTAGCTGG + Intergenic
1018598592 6:165512941-165512963 TCTCAAAGAGAATATATAAATGG - Intronic
1019763335 7:2830504-2830526 TCCCAAAGAGAGAACCTGGAGGG + Intronic
1020940814 7:14534563-14534585 TCTTATAGAGAGAATCTAGTTGG - Intronic
1021426875 7:20510080-20510102 TCTTAAAAAGAGAATGCTGATGG - Intergenic
1022351711 7:29572381-29572403 TTTCAAACAGAGTATGGAGAAGG - Intergenic
1022689201 7:32629544-32629566 TCACAAAGACAGAAAGTAGATGG + Intergenic
1023078054 7:36502824-36502846 TCTGTAAGAGAGAAGGTAAATGG - Intergenic
1023370626 7:39508996-39509018 TCCCTCAGAGAGAAGGTAGAGGG - Intergenic
1023603070 7:41899599-41899621 TCCCAGAGAGAGATTGTTGAAGG - Intergenic
1027655246 7:80922135-80922157 TTTCAATGAGAGAACGTTGAAGG + Intronic
1027773580 7:82437038-82437060 TCTCTAAGAGAAATTGTTGAGGG - Intronic
1029625071 7:101715732-101715754 TCTCAAAAAAAGAATGAAGCTGG + Intergenic
1030290239 7:107864817-107864839 TCTGAAGGACAGAAAGTAGAGGG + Intergenic
1031210454 7:118818902-118818924 ACTAAAAGAGAGCATGCAGATGG - Intergenic
1033432665 7:141303404-141303426 TCTCAAGGATAGAATTTGGATGG - Intronic
1033536679 7:142319264-142319286 TCTAAAAGAGAGAGTATAGATGG + Intergenic
1035451184 7:158977896-158977918 TCACAGAGACAGAAGGTAGAAGG - Intergenic
1035943307 8:3929267-3929289 TCTCATTGAGGGAATGTAGGGGG - Intronic
1037383979 8:18317916-18317938 TGTCACAGAGAGAATGCAGCTGG - Intergenic
1038067254 8:23975889-23975911 TATCAAAGAGGGATTCTAGAAGG + Intergenic
1041225702 8:55695710-55695732 TCTCAATAGGAGAATGTATAAGG - Intergenic
1042951951 8:74209589-74209611 TCACAAAGAGAACATGGAGAGGG + Intergenic
1044348214 8:91131521-91131543 TATGAATGAGAGAATGTAAAGGG - Intronic
1044526875 8:93262232-93262254 TCTCTCAGTGAGAATGAAGAAGG + Intergenic
1044744033 8:95355039-95355061 TCTCAAAGGCAAAATATAGAGGG + Intergenic
1045052797 8:98342204-98342226 TCTAAAAGCAAGAATGCAGATGG + Intergenic
1045357381 8:101401912-101401934 CCTCAGAGACAGAATGCAGAGGG - Intergenic
1045427156 8:102078351-102078373 TGTGAAAAATAGAATGTAGAGGG - Intronic
1045735484 8:105291545-105291567 TCTCATAGACAGCATGTAGTTGG - Intronic
1046004596 8:108464011-108464033 TCTCAGAGAGAGATTTTATAAGG - Intronic
1046833904 8:118778430-118778452 TCTCAAGGAGAAAATCTAGGTGG + Intergenic
1047083578 8:121491935-121491957 TCTAAAACTGAGATTGTAGAGGG - Intergenic
1047791361 8:128206961-128206983 TCTCAAAGAGAGACTTGAAATGG + Intergenic
1050412133 9:5377569-5377591 TCTGAAAGAGAGAAAGCAGATGG + Intronic
1052105872 9:24515186-24515208 TCTCATAGAGAGAATAGAGGAGG - Intergenic
1052437940 9:28454102-28454124 TCTCAAAGAGATAACCTAGAAGG + Intronic
1053003085 9:34588606-34588628 TCTCAAAAAGAGAGACTAGACGG + Intronic
1053779763 9:41594430-41594452 TCTCAAAGATTGAGTGTTGAAGG - Intergenic
1054167719 9:61804671-61804693 TCTCAAAGATTGAGTGTTGAAGG - Intergenic
1054669826 9:67776235-67776257 TCTCAAAGACTGAGTGTTGAAGG + Intergenic
1056207138 9:84331064-84331086 TCTCAGAGAGAGAGGGTATAAGG - Intronic
1056838041 9:89973701-89973723 TCACAGAGACAGAATGTCGAAGG - Intergenic
1056928788 9:90857720-90857742 TCTCAAAGAGAGCTGGGAGAGGG - Intronic
1058107586 9:100990427-100990449 TCTCCAAGAGTGAGAGTAGAAGG + Intergenic
1060196514 9:121627462-121627484 TCTGAAGGATAGCATGTAGAAGG + Intronic
1062486161 9:136777219-136777241 TCTCAGGAAGAGAATGGAGACGG + Intergenic
1186567704 X:10681590-10681612 TTTCCAAGAGAGATTGTAAAAGG - Intronic
1187410236 X:19044797-19044819 TCTCAAAGAGAGAATGTACATGG + Intronic
1187828491 X:23356827-23356849 TCTCAATCAGAAAATGTAGCTGG - Intronic
1189306636 X:39991836-39991858 TCTGAAAGAAAGAATATAGATGG + Intergenic
1190567683 X:51747405-51747427 ACACAAAGGGACAATGTAGAAGG - Intergenic
1191910790 X:66147225-66147247 TCTGAAAGATAGAAAGAAGAAGG - Intergenic
1191977561 X:66890452-66890474 TCTCAAAGTGAGAATGAAGAAGG - Intergenic
1192085662 X:68094746-68094768 GCTCGAAGAGATAATGGAGAGGG - Intronic
1192667611 X:73104096-73104118 TCCCAAAGAGAGAGGATAGATGG - Intergenic
1193162095 X:78240092-78240114 TCTCACAGAGAGAAAATTGAAGG + Intergenic
1193471836 X:81914288-81914310 TTTGAAAGTGAGAATGGAGAAGG + Intergenic
1193804464 X:85977375-85977397 TCTCAAAGTGAGAAACTAAATGG - Intronic
1197060026 X:122166892-122166914 ACTCAAAGAGACAGAGTAGAAGG + Intergenic
1197515321 X:127420776-127420798 TCTCTAAGACAGACTATAGATGG - Intergenic
1198143606 X:133831800-133831822 TGCCAAAGAGGGTATGTAGATGG + Intronic
1199441952 X:147878553-147878575 TCCAAAAGAGAAAAAGTAGAAGG - Intergenic
1199491783 X:148407949-148407971 TATCAAAGGGAGAATGTAGATGG - Intergenic
1199642845 X:149881062-149881084 TCTCAAAGTGAGAACCTTGAGGG + Intergenic
1199955733 X:152740806-152740828 GCCCAAAGAGAGACTGGAGAAGG - Intergenic
1201944034 Y:19491623-19491645 TCTCACTAAGAGAATGAAGAGGG + Intergenic