ID: 993165064

View in Genome Browser
Species Human (GRCh38)
Location 5:84342401-84342423
Sequence ATGGAGACTCAGAAAGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993165057_993165064 7 Left 993165057 5:84342371-84342393 CCAACCTAATAGAATTTAGAATG 0: 1
1: 0
2: 0
3: 19
4: 221
Right 993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG No data
993165058_993165064 3 Left 993165058 5:84342375-84342397 CCTAATAGAATTTAGAATGACAG 0: 1
1: 0
2: 2
3: 21
4: 234
Right 993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993165064 Original CRISPR ATGGAGACTCAGAAAGGTGG GGG Intronic
No off target data available for this crispr