ID: 993168411

View in Genome Browser
Species Human (GRCh38)
Location 5:84384765-84384787
Sequence GTTCTCCGCGCGGCGGCTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993168402_993168411 16 Left 993168402 5:84384726-84384748 CCACCGGCAGACAGGCGGACCGG 0: 1
1: 0
2: 0
3: 20
4: 83
Right 993168411 5:84384765-84384787 GTTCTCCGCGCGGCGGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 87
993168407_993168411 -3 Left 993168407 5:84384745-84384767 CCGGGCGCTCGGCTGTCGCTGTT 0: 1
1: 0
2: 1
3: 3
4: 52
Right 993168411 5:84384765-84384787 GTTCTCCGCGCGGCGGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 87
993168401_993168411 17 Left 993168401 5:84384725-84384747 CCCACCGGCAGACAGGCGGACCG 0: 1
1: 0
2: 1
3: 15
4: 51
Right 993168411 5:84384765-84384787 GTTCTCCGCGCGGCGGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 87
993168405_993168411 13 Left 993168405 5:84384729-84384751 CCGGCAGACAGGCGGACCGGGCG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 993168411 5:84384765-84384787 GTTCTCCGCGCGGCGGCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993168411 Original CRISPR GTTCTCCGCGCGGCGGCTGC GGG Exonic
901057468 1:6455364-6455386 CTGCCCCGCGTGGCGGCTGCCGG + Intronic
905066884 1:35192237-35192259 CTTCTCCTCGCTGCGGCCGCCGG + Exonic
906719741 1:47996708-47996730 GTCCTCCGTCCGGGGGCTGCGGG + Exonic
922315059 1:224434626-224434648 GGGCGCCGCGGGGCGGCTGCGGG + Intronic
923744263 1:236686312-236686334 GGCCTCTGGGCGGCGGCTGCAGG + Intergenic
1064991649 10:21261911-21261933 GGTCTCCAGGCGGCTGCTGCTGG - Intergenic
1069052682 10:63811627-63811649 GCTTTCAGCGGGGCGGCTGCCGG + Intergenic
1073181773 10:101587915-101587937 GTGCTCAGCGCCGCAGCTGCGGG + Exonic
1074985454 10:118654860-118654882 ATTCTCCGCGCGGTCGCTGTTGG + Intergenic
1075263094 10:120979793-120979815 GTTAAGCGCGCGGCGGCAGCAGG - Intergenic
1076329147 10:129652287-129652309 CGTCTCCGCTCGGGGGCTGCTGG - Intronic
1076329228 10:129652686-129652708 GTCCTCCGCACGTCAGCTGCCGG + Intronic
1076722148 10:132397399-132397421 GGTCTCCGGGCGGCGGAGGCGGG - Intronic
1076789956 10:132771644-132771666 ACTCTTCGCGGGGCGGCTGCCGG - Intronic
1076792465 10:132784676-132784698 GTTCCCGGTGCGGAGGCTGCGGG - Intergenic
1077201604 11:1310095-1310117 TTCCTCCACGGGGCGGCTGCCGG + Intergenic
1077805730 11:5589901-5589923 GGTCTGCGCGCGGCGCTTGCGGG + Intronic
1084085208 11:66851887-66851909 GTGCCCCTGGCGGCGGCTGCAGG - Exonic
1094125047 12:27014488-27014510 GTTCCCCGCGCGCCGGCAGGAGG - Intergenic
1094837907 12:34330806-34330828 GGTCTCCGCGCAGGGGCTGCTGG + Intergenic
1098029050 12:66235414-66235436 TCTCGCCGCGCGGCGGCGGCCGG + Intronic
1105459104 13:20567119-20567141 GTCCTCCGCGCGGGGGCGGGCGG - Exonic
1106517045 13:30465013-30465035 GTTCTCCGTGCGGGGGCGGCGGG - Intronic
1106568396 13:30906273-30906295 TTTCTCCGCGCGGTGCCTGCAGG + Exonic
1111672763 13:91348995-91349017 GGTCGCCGCGCGGCTGCCGCCGG + Intergenic
1113985666 13:114314184-114314206 GATATCCGCACGGCGGCGGCAGG + Intergenic
1119036306 14:71232624-71232646 GCTCTCTGCGAGGCTGCTGCTGG - Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122517663 14:102319954-102319976 GGACGCGGCGCGGCGGCTGCGGG + Exonic
1122609805 14:102974069-102974091 GGACTCCACGCAGCGGCTGCGGG - Exonic
1125329181 15:38565174-38565196 GTGCTCCGAGCAGCGGCCGCAGG - Intronic
1125503199 15:40252305-40252327 GGTCTCCGCGAGGCGGCCACTGG + Exonic
1131056356 15:89377631-89377653 GTTCTCCGCGATGCGCTTGCTGG + Intergenic
1132286798 15:100669377-100669399 GTCCTCCCAGGGGCGGCTGCTGG + Intergenic
1132805404 16:1772966-1772988 GTTCTCTGGACGCCGGCTGCCGG - Exonic
1136536341 16:30902113-30902135 CTTCTCGCCGCCGCGGCTGCCGG + Exonic
1141831185 16:86510691-86510713 CTTCTCCGGGCGCCGGATGCCGG - Exonic
1147743706 17:42682792-42682814 GTTCACAGGGAGGCGGCTGCCGG + Exonic
1148787188 17:50151071-50151093 TTTGCCCGAGCGGCGGCTGCCGG + Intergenic
1151370214 17:73643033-73643055 GGTGTCCGAGCGGCGCCTGCTGG - Intronic
1151421151 17:73998821-73998843 GTTCTCAGCGCTCAGGCTGCAGG - Intergenic
1151877070 17:76872914-76872936 GTTCTCGGCCCGGCGCCTGGGGG + Exonic
1152624542 17:81382220-81382242 CTTCTCCACACGGCGGCAGCAGG - Intergenic
1152703850 17:81833052-81833074 GTTCCCCGCCCGGCACCTGCAGG - Intronic
1152718543 17:81911359-81911381 GCTGTCCGCGCCGCCGCTGCGGG - Exonic
1153480575 18:5543360-5543382 GCTCAGCGCGCGGCGGCAGCGGG - Intronic
1154202379 18:12308372-12308394 CCTCTCCGCGGGTCGGCTGCTGG + Intronic
1155257911 18:24014639-24014661 GTAATCCCCGCGGCGGCGGCCGG + Exonic
1160499849 18:79396207-79396229 GGCATCCGCGCGGCGGCGGCGGG - Exonic
1160577247 18:79863684-79863706 GCTCCCCGGGCGGCGGCGGCGGG + Exonic
1161089525 19:2353026-2353048 GTTCTTCGCTGGGCGGCTGCGGG - Exonic
1163167617 19:15508684-15508706 GGTCTGCGCGCGGCGGCGGGCGG + Intronic
1165532890 19:36418648-36418670 GGGCTGCGCGCGGAGGCTGCTGG + Exonic
1166393810 19:42424571-42424593 TTTCTCAGCGCCGGGGCTGCTGG - Intronic
926252772 2:11165255-11165277 CTTCTCAGAGGGGCGGCTGCCGG + Intronic
941020966 2:160407655-160407677 TCTCGCCGCGCGGCGGCGGCCGG + Intronic
943669985 2:190649500-190649522 GGGCTCCGCGCGGCCGCCGCCGG + Intronic
948606603 2:239139720-239139742 GTTCTCCGCGCTGACGCTCCCGG + Exonic
1173909153 20:46651367-46651389 GTGGAGCGCGCGGCGGCTGCTGG - Exonic
1174804461 20:53593779-53593801 TTTCCTCGCGCGGCGGCGGCCGG + Exonic
1176120649 20:63453107-63453129 GTCCACCGCGGGGCGGCAGCTGG - Intronic
1180560366 22:16610182-16610204 TTTCCTCGCGCGGCGGCGGCCGG + Intergenic
1180801562 22:18634325-18634347 GGTCAGCGAGCGGCGGCTGCAGG + Intergenic
1181220160 22:21360936-21360958 GGTCAGCGAGCGGCGGCTGCAGG - Intergenic
1183535486 22:38398461-38398483 TTTCCTCGCGCGGCGGCTGCCGG + Intronic
1185206352 22:49541352-49541374 CTGCTCCGCGCGGGAGCTGCAGG - Intronic
962367493 3:134795957-134795979 GCTCTCCGAGCGGGGGCTGCGGG - Intronic
968471554 4:784866-784888 GTTCTCTCCACGGCGGCTGCAGG - Intergenic
983230691 4:165126275-165126297 GTGCTGCGCGCGGCGCTTGCGGG - Intronic
983904446 4:173169243-173169265 GCTCTCCGCGCCGGGACTGCGGG + Intronic
988652105 5:33164163-33164185 GTTCTCAGCTTGGCTGCTGCTGG + Intergenic
993168411 5:84384765-84384787 GTTCTCCGCGCGGCGGCTGCGGG + Exonic
1002896748 6:1384074-1384096 CTTCCCCGCGCGGCCGCAGCCGG + Intergenic
1007581146 6:42960880-42960902 GTACTCGGCGGTGCGGCTGCGGG - Exonic
1013099526 6:106974984-106975006 GGTATCCCCGCGCCGGCTGCGGG + Intronic
1014632495 6:123803754-123803776 GCTCGCCGCGCGCCGGCTCCGGG - Intergenic
1018081669 6:160264072-160264094 GTTCTCCGTGAGGCCGCTGTGGG - Intronic
1019487764 7:1297133-1297155 GTGCCCAGCACGGCGGCTGCAGG - Intergenic
1022395980 7:29988992-29989014 GTTCTCCGCGGGGCGCCGGGCGG - Intronic
1022739732 7:33109457-33109479 TTCCTCCGCGCGGCGGTCGCGGG + Intergenic
1023041188 7:36174543-36174565 GGTCTCCGCCAGGCAGCTGCTGG + Intronic
1033899441 7:146116884-146116906 CGGCTCCGCGCGCCGGCTGCGGG + Exonic
1035663755 8:1365301-1365323 GATCTCCGCACCGAGGCTGCAGG + Intergenic
1036561443 8:9903296-9903318 GACCTCCGCGCAGCGGCCGCGGG - Intergenic
1039949009 8:42153263-42153285 CTTCCCGGCGCCGCGGCTGCGGG + Intronic
1046445301 8:114311374-114311396 GTGCTGCGCGCGGCGCTTGCGGG + Intergenic
1056773894 9:89497930-89497952 GTCCTGCCCGCGGCGGCTCCCGG + Intronic
1057546257 9:96021882-96021904 GTTCCGAGCGCAGCGGCTGCGGG + Intergenic
1059208405 9:112487227-112487249 GGTCACCGCGCGGCCGCTGACGG - Intronic
1062198495 9:135287893-135287915 GTTTTCTGAGCGGCCGCTGCAGG + Intergenic
1189323067 X:40097784-40097806 GCTCTCCGCCCGGCGGCTCGCGG + Intronic
1191830211 X:65407596-65407618 GTTTTCCCCGAGGCGGCGGCGGG - Intronic
1196734949 X:118975056-118975078 GCTCTCCGAGCGGCAGCAGCTGG + Exonic
1199626921 X:149750076-149750098 GTGCTCCGTGGGGGGGCTGCAGG - Intergenic
1200239887 X:154487881-154487903 GTTCTCCCAGCTGCTGCTGCAGG - Exonic