ID: 993177359

View in Genome Browser
Species Human (GRCh38)
Location 5:84503708-84503730
Sequence CAGGATTTGGAGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993177349_993177359 20 Left 993177349 5:84503665-84503687 CCCTGTCTAACTTTACTAGATAC No data
Right 993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG No data
993177350_993177359 19 Left 993177350 5:84503666-84503688 CCTGTCTAACTTTACTAGATACT No data
Right 993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993177359 Original CRISPR CAGGATTTGGAGAGGGAGGC TGG Intergenic
No off target data available for this crispr