ID: 993183724

View in Genome Browser
Species Human (GRCh38)
Location 5:84588831-84588853
Sequence GGTTATAAGCAGGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993183717_993183724 20 Left 993183717 5:84588788-84588810 CCAGGTGTAGAAAGGAGTCACCA No data
Right 993183724 5:84588831-84588853 GGTTATAAGCAGGAGGTGGAAGG No data
993183719_993183724 0 Left 993183719 5:84588808-84588830 CCATCTTGGCTAGAGTAATTGAT No data
Right 993183724 5:84588831-84588853 GGTTATAAGCAGGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993183724 Original CRISPR GGTTATAAGCAGGAGGTGGA AGG Intergenic
No off target data available for this crispr