ID: 993184659

View in Genome Browser
Species Human (GRCh38)
Location 5:84601766-84601788
Sequence GCAGGTTGTAAGGGATCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993184654_993184659 8 Left 993184654 5:84601735-84601757 CCATGTTCACACTTAGGTCAGTG No data
Right 993184659 5:84601766-84601788 GCAGGTTGTAAGGGATCTGCTGG No data
993184653_993184659 11 Left 993184653 5:84601732-84601754 CCGCCATGTTCACACTTAGGTCA No data
Right 993184659 5:84601766-84601788 GCAGGTTGTAAGGGATCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993184659 Original CRISPR GCAGGTTGTAAGGGATCTGC TGG Intergenic
No off target data available for this crispr