ID: 993188989

View in Genome Browser
Species Human (GRCh38)
Location 5:84656930-84656952
Sequence CTGGGGGTGGGGAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993188972_993188989 6 Left 993188972 5:84656901-84656923 CCCTAACCTTTTTGGCACCAGGG 0: 63
1: 1050
2: 1604
3: 1306
4: 894
Right 993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG No data
993188977_993188989 0 Left 993188977 5:84656907-84656929 CCTTTTTGGCACCAGGGATGGGT 0: 10
1: 80
2: 793
3: 1419
4: 1382
Right 993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG No data
993188974_993188989 5 Left 993188974 5:84656902-84656924 CCTAACCTTTTTGGCACCAGGGA 0: 956
1: 1606
2: 1390
3: 917
4: 585
Right 993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993188989 Original CRISPR CTGGGGGTGGGGAGGGAGGA TGG Intergenic
No off target data available for this crispr