ID: 993190333

View in Genome Browser
Species Human (GRCh38)
Location 5:84672309-84672331
Sequence GGAGCTGCTTAGTTTATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993190329_993190333 28 Left 993190329 5:84672258-84672280 CCTATTGACACTTGGACAATGCA No data
Right 993190333 5:84672309-84672331 GGAGCTGCTTAGTTTATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993190333 Original CRISPR GGAGCTGCTTAGTTTATGGA TGG Intergenic
No off target data available for this crispr