ID: 993194385

View in Genome Browser
Species Human (GRCh38)
Location 5:84722399-84722421
Sequence CTGTGGAAAGATATGAGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993194385_993194393 23 Left 993194385 5:84722399-84722421 CCCCTACTCATATCTTTCCACAG No data
Right 993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG No data
993194385_993194389 4 Left 993194385 5:84722399-84722421 CCCCTACTCATATCTTTCCACAG No data
Right 993194389 5:84722426-84722448 AATAATTTTGCAGCCATCCATGG No data
993194385_993194392 22 Left 993194385 5:84722399-84722421 CCCCTACTCATATCTTTCCACAG No data
Right 993194392 5:84722444-84722466 CATGGACAAAAGTGCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993194385 Original CRISPR CTGTGGAAAGATATGAGTAG GGG (reversed) Intergenic
No off target data available for this crispr