ID: 993194386

View in Genome Browser
Species Human (GRCh38)
Location 5:84722400-84722422
Sequence GCTGTGGAAAGATATGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993194386_993194394 30 Left 993194386 5:84722400-84722422 CCCTACTCATATCTTTCCACAGC No data
Right 993194394 5:84722453-84722475 AAGTGCCTTTGTGGGAGCCCTGG No data
993194386_993194392 21 Left 993194386 5:84722400-84722422 CCCTACTCATATCTTTCCACAGC No data
Right 993194392 5:84722444-84722466 CATGGACAAAAGTGCCTTTGTGG No data
993194386_993194389 3 Left 993194386 5:84722400-84722422 CCCTACTCATATCTTTCCACAGC No data
Right 993194389 5:84722426-84722448 AATAATTTTGCAGCCATCCATGG No data
993194386_993194393 22 Left 993194386 5:84722400-84722422 CCCTACTCATATCTTTCCACAGC No data
Right 993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993194386 Original CRISPR GCTGTGGAAAGATATGAGTA GGG (reversed) Intergenic
No off target data available for this crispr