ID: 993194387

View in Genome Browser
Species Human (GRCh38)
Location 5:84722401-84722423
Sequence TGCTGTGGAAAGATATGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993194387_993194389 2 Left 993194387 5:84722401-84722423 CCTACTCATATCTTTCCACAGCA No data
Right 993194389 5:84722426-84722448 AATAATTTTGCAGCCATCCATGG No data
993194387_993194393 21 Left 993194387 5:84722401-84722423 CCTACTCATATCTTTCCACAGCA No data
Right 993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG No data
993194387_993194392 20 Left 993194387 5:84722401-84722423 CCTACTCATATCTTTCCACAGCA No data
Right 993194392 5:84722444-84722466 CATGGACAAAAGTGCCTTTGTGG No data
993194387_993194394 29 Left 993194387 5:84722401-84722423 CCTACTCATATCTTTCCACAGCA No data
Right 993194394 5:84722453-84722475 AAGTGCCTTTGTGGGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993194387 Original CRISPR TGCTGTGGAAAGATATGAGT AGG (reversed) Intergenic
No off target data available for this crispr