ID: 993194388

View in Genome Browser
Species Human (GRCh38)
Location 5:84722416-84722438
Sequence CTGCAAAATTATTTTTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993194388_993194392 5 Left 993194388 5:84722416-84722438 CCACAGCAAAAATAATTTTGCAG No data
Right 993194392 5:84722444-84722466 CATGGACAAAAGTGCCTTTGTGG No data
993194388_993194393 6 Left 993194388 5:84722416-84722438 CCACAGCAAAAATAATTTTGCAG No data
Right 993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG No data
993194388_993194394 14 Left 993194388 5:84722416-84722438 CCACAGCAAAAATAATTTTGCAG No data
Right 993194394 5:84722453-84722475 AAGTGCCTTTGTGGGAGCCCTGG No data
993194388_993194396 26 Left 993194388 5:84722416-84722438 CCACAGCAAAAATAATTTTGCAG No data
Right 993194396 5:84722465-84722487 GGGAGCCCTGGTATTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993194388 Original CRISPR CTGCAAAATTATTTTTGCTG TGG (reversed) Intergenic
No off target data available for this crispr