ID: 993194389

View in Genome Browser
Species Human (GRCh38)
Location 5:84722426-84722448
Sequence AATAATTTTGCAGCCATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993194387_993194389 2 Left 993194387 5:84722401-84722423 CCTACTCATATCTTTCCACAGCA No data
Right 993194389 5:84722426-84722448 AATAATTTTGCAGCCATCCATGG No data
993194385_993194389 4 Left 993194385 5:84722399-84722421 CCCCTACTCATATCTTTCCACAG No data
Right 993194389 5:84722426-84722448 AATAATTTTGCAGCCATCCATGG No data
993194386_993194389 3 Left 993194386 5:84722400-84722422 CCCTACTCATATCTTTCCACAGC No data
Right 993194389 5:84722426-84722448 AATAATTTTGCAGCCATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993194389 Original CRISPR AATAATTTTGCAGCCATCCA TGG Intergenic
No off target data available for this crispr