ID: 993194394

View in Genome Browser
Species Human (GRCh38)
Location 5:84722453-84722475
Sequence AAGTGCCTTTGTGGGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993194388_993194394 14 Left 993194388 5:84722416-84722438 CCACAGCAAAAATAATTTTGCAG No data
Right 993194394 5:84722453-84722475 AAGTGCCTTTGTGGGAGCCCTGG No data
993194386_993194394 30 Left 993194386 5:84722400-84722422 CCCTACTCATATCTTTCCACAGC No data
Right 993194394 5:84722453-84722475 AAGTGCCTTTGTGGGAGCCCTGG No data
993194390_993194394 -9 Left 993194390 5:84722439-84722461 CCATCCATGGACAAAAGTGCCTT No data
Right 993194394 5:84722453-84722475 AAGTGCCTTTGTGGGAGCCCTGG No data
993194387_993194394 29 Left 993194387 5:84722401-84722423 CCTACTCATATCTTTCCACAGCA No data
Right 993194394 5:84722453-84722475 AAGTGCCTTTGTGGGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993194394 Original CRISPR AAGTGCCTTTGTGGGAGCCC TGG Intergenic
No off target data available for this crispr