ID: 993202232

View in Genome Browser
Species Human (GRCh38)
Location 5:84830611-84830633
Sequence CGCCCACCTGGAACTCCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993202226_993202232 23 Left 993202226 5:84830565-84830587 CCTTCACTGCTCGGGGCTGGCTG No data
Right 993202232 5:84830611-84830633 CGCCCACCTGGAACTCCCGCTGG No data
993202228_993202232 -6 Left 993202228 5:84830594-84830616 CCTGCCGCTTGAGCCAACGCCCA No data
Right 993202232 5:84830611-84830633 CGCCCACCTGGAACTCCCGCTGG No data
993202229_993202232 -10 Left 993202229 5:84830598-84830620 CCGCTTGAGCCAACGCCCACCTG No data
Right 993202232 5:84830611-84830633 CGCCCACCTGGAACTCCCGCTGG No data
993202225_993202232 24 Left 993202225 5:84830564-84830586 CCCTTCACTGCTCGGGGCTGGCT No data
Right 993202232 5:84830611-84830633 CGCCCACCTGGAACTCCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993202232 Original CRISPR CGCCCACCTGGAACTCCCGC TGG Intergenic
No off target data available for this crispr